EMAIL THIS PAGE TO A FRIEND

C1QTNF5

C1q and tumor necrosis factor related protein 5

78 Gene Product Result for
Synonyms: CTRP5
UniProtKB ID: Q9BXJ0, A6NDD3, B0YJ35, Q335M2, Q8N6P2, Q9UFX4
Gene ID:
Human(114902) Summary: This gene encodes a member of a family of proteins that function as components of basement membranes and may play a role in cell adhesion. Mutations in this gene have been associated with late-onset retinal degeneration. The protein may be encoded by either a bicistronic transcript including sequence from the upstream membrane frizzled-related protein gene (MFRP), or by a monocistronic transcript expressed from an internal promoter. [provided by RefSeq, Jun 2013]
Mouse(235312) C1q and tumor necrosis factor related protein 5
Rat(315598) C1q and tumor necrosis factor related protein 5
domestic guinea pig(100717664) C1q and tumor necrosis factor related protein 5
naked mole-rat(101711951) C1q and tumor necrosis factor related protein 5
sheep(101115903) C1q and tumor necrosis factor related protein 5
Zebrafish(555815) C1q and tumor necrosis factor related protein 5
chicken(769989) C1q and tumor necrosis factor related protein 5
dog(610562) C1q and tumor necrosis factor related protein 5
domestic cat(101097272) C1q and tumor necrosis factor related protein 5
cow(614671) C1q and tumor necrosis factor related protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1294 Human C1qTNF5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015645 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU199381 MISSION® esiRNA esiRNA targeting mouse C1qtnf5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015645 Rosetta Predictions human pricing
NM_001012123 Rosetta Predictions rat pricing
XM_576395 Rosetta Predictions rat pricing
NM_001040631 Rosetta Predictions mouse pricing
NM_001040632 Rosetta Predictions mouse pricing
NM_145613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149005 predicted 1033
2 SASI_Hs01_00149006 predicted 1108
3 SASI_Hs01_00149007 predicted 430
4 SASI_Hs01_00149008 predicted 1110
5 SASI_Hs01_00149009 predicted 564
6 SASI_Hs01_00149010 predicted 1004
7 SASI_Hs01_00149011 predicted 1112
8 SASI_Hs01_00149012 predicted 316
9 SASI_Hs01_00149013 predicted 1066
10 SASI_Hs01_00149014 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101343 predicted 898
2 SASI_Rn01_00101344 predicted 909
3 SASI_Rn01_00101345 predicted 859
4 SASI_Rn01_00101347 predicted 987
5 SASI_Rn01_00101348 predicted 1041
6 SASI_Rn01_00101349 predicted 534
7 SASI_Rn01_00101350 predicted 811
8 SASI_Rn01_00101351 predicted 746
9 SASI_Rn01_00101352 predicted 716
10 SASI_Rn02_00200288 predicted 570
11 SASI_Rn01_00101346 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177013 predicted 901
2 SASI_Rn01_00177014 predicted 910
3 SASI_Rn01_00177015 predicted 861
4 SASI_Rn01_00177016 predicted 714
5 SASI_Rn01_00177017 predicted 991
6 SASI_Rn01_00177018 predicted 1053
7 SASI_Rn01_00177019 predicted 545
8 SASI_Rn01_00177020 predicted 807
9 SASI_Rn01_00177021 predicted 743
10 SASI_Rn01_00177022 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081055 predicted 631
2 SASI_Mm01_00081056 predicted 815
3 SASI_Mm01_00081058 predicted 1032
4 SASI_Mm01_00081059 predicted 822
5 SASI_Mm01_00081060 predicted 789
6 SASI_Mm01_00081061 predicted 780
7 SASI_Mm01_00081062 predicted 965
8 SASI_Mm01_00081063 predicted 594
9 SASI_Mm01_00081064 predicted 489
10 SASI_Mm02_00290332 predicted 621
11 SASI_Mm01_00081057 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133561 predicted 749
2 SASI_Mm01_00133562 predicted 937
3 SASI_Mm01_00133564 predicted 1151
4 SASI_Mm01_00133565 predicted 940
5 SASI_Mm01_00133566 predicted 910
6 SASI_Mm01_00133567 predicted 895
7 SASI_Mm01_00133568 predicted 1083
8 SASI_Mm01_00133569 predicted 706
9 SASI_Mm01_00133570 predicted 608
10 SASI_Mm02_00290333 predicted 740
11 SASI_Mm01_00133563 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131010 predicted 3580
2 SASI_Mm01_00131011 predicted 3759
3 SASI_Mm01_00131013 predicted 3974
4 SASI_Mm01_00131014 predicted 3771
5 SASI_Mm01_00131015 predicted 3734
6 SASI_Mm01_00131016 predicted 3724
7 SASI_Mm01_00131017 predicted 3915
8 SASI_Mm01_00131018 predicted 3534
9 SASI_Mm01_00131019 predicted 3430
10 SASI_Mm02_00341188 predicted 3565
11 SASI_Mm01_00131012 predicted 3863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145613
VALIDATED
C1QTNF5 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145613.2-4033s1c1
Sequence:CCGGCCAGGACTTTAGAATGCAGTACTCGAGTACTGCATTCTAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145613.2-3766s1c1
Sequence:CCGGGACAGTACCTTCTCTGGATTTCTCGAGAAATCCAGAGAAGGTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145613.2-3726s1c1
Sequence:CCGGCGTGGGTGATTACATTGGCATCTCGAGATGCCAATGTAATCACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145613.2-3483s1c1
Sequence:CCGGGCTAAATGAGCAGGGCCATTACTCGAGTAATGGCCCTGCTCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145613.2-3543s1c1
Sequence:CCGGCGTCTACTACTTTGCTGTGCACTCGAGTGCACAGCAAAGTAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145613
VALIDATED
C1QTNF5 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145613.2-4033s1c1
Sequence:CCGGCCAGGACTTTAGAATGCAGTACTCGAGTACTGCATTCTAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145613.2-3766s1c1
Sequence:CCGGGACAGTACCTTCTCTGGATTTCTCGAGAAATCCAGAGAAGGTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145613.2-3726s1c1
Sequence:CCGGCGTGGGTGATTACATTGGCATCTCGAGATGCCAATGTAATCACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145613.2-3483s1c1
Sequence:CCGGGCTAAATGAGCAGGGCCATTACTCGAGTAATGGCCCTGCTCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145613.2-3543s1c1
Sequence:CCGGCGTCTACTACTTTGCTGTGCACTCGAGTGCACAGCAAAGTAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145613
VALIDATED
C1QTNF5 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145613.2-4033s1c1
Sequence:CCGGCCAGGACTTTAGAATGCAGTACTCGAGTACTGCATTCTAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145613.2-3766s1c1
Sequence:CCGGGACAGTACCTTCTCTGGATTTCTCGAGAAATCCAGAGAAGGTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145613.2-3726s1c1
Sequence:CCGGCGTGGGTGATTACATTGGCATCTCGAGATGCCAATGTAATCACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145613.2-3483s1c1
Sequence:CCGGGCTAAATGAGCAGGGCCATTACTCGAGTAATGGCCCTGCTCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145613.2-3543s1c1
Sequence:CCGGCGTCTACTACTTTGCTGTGCACTCGAGTGCACAGCAAAGTAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015645
C1QTNF5 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000377724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3467s21c1
Sequence:CCGGACAGCACCTTCTCCGGATTTCCTCGAGGAAATCCGGAGAAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015645.3-3757s21c1
Sequence:CCGGTGCTGTGCTGGCAAGTGTAAGCTCGAGCTTACACTTGCCAGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3184s21c1
Sequence:CCGGGTGAACGAGCAGGGACATTACCTCGAGGTAATGTCCCTGCTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3431s21c1
Sequence:CCGGGTGACTACATTGGCATCTATGCTCGAGCATAGATGCCAATGTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015645
C1QTNF5 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000377724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3467s21c1
Sequence:CCGGACAGCACCTTCTCCGGATTTCCTCGAGGAAATCCGGAGAAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015645.3-3757s21c1
Sequence:CCGGTGCTGTGCTGGCAAGTGTAAGCTCGAGCTTACACTTGCCAGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3184s21c1
Sequence:CCGGGTGAACGAGCAGGGACATTACCTCGAGGTAATGTCCCTGCTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3431s21c1
Sequence:CCGGGTGACTACATTGGCATCTATGCTCGAGCATAGATGCCAATGTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015645
C1QTNF5 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000377724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3467s21c1
Sequence:CCGGACAGCACCTTCTCCGGATTTCCTCGAGGAAATCCGGAGAAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015645.3-3757s21c1
Sequence:CCGGTGCTGTGCTGGCAAGTGTAAGCTCGAGCTTACACTTGCCAGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3184s21c1
Sequence:CCGGGTGAACGAGCAGGGACATTACCTCGAGGTAATGTCCCTGCTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015645.3-3431s21c1
Sequence:CCGGGTGACTACATTGGCATCTATGCTCGAGCATAGATGCCAATGTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks