EMAIL THIS PAGE TO A FRIEND

C1QTNF6

C1q and tumor necrosis factor related protein 6

68 Gene Product Result for
Synonyms: CTFP6 CTRP6 ZACRP6
UniProtKB ID: Q9BXI9, Q5H9G8, Q6ZRM7
Gene ID:
Mouse(72709) C1q and tumor necrosis factor related protein 6
Rat(315114) C1q and tumor necrosis factor related protein 6
chicken(427908) C1q and tumor necrosis factor related protein 6
dog(481273) C1q and tumor necrosis factor related protein 6
cow(506413) C1q and tumor necrosis factor related protein 6
domestic cat(101096245) C1q and tumor necrosis factor related protein 6
sheep(101102801) C1q and tumor necrosis factor related protein 6
naked mole-rat(101726000) C1q and tumor necrosis factor related protein 6
domestic guinea pig(100730920) C1q and tumor necrosis factor related protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031910 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081191 MISSION® esiRNA esiRNA targeting mouse C1qtnf6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031910 Rosetta Predictions human pricing
NM_182486 Rosetta Predictions human pricing
NM_001034932 Rosetta Predictions rat pricing
NM_028331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089039 predicted 576
2 SASI_Hs01_00089040 predicted 384
3 SASI_Hs01_00089042 predicted 679
4 SASI_Hs02_00359037 predicted 686
5 SASI_Hs01_00089043 predicted 322
6 SASI_Hs01_00089044 predicted 582
7 SASI_Hs01_00089045 predicted 723
8 SASI_Hs01_00089047 predicted 336
9 SASI_Hs01_00089046 predicted 275
10 SASI_Hs01_00089048 predicted 1321
11 SASI_Hs01_00089041 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018654 predicted 572
2 SASI_Hs01_00018655 predicted 382
3 SASI_Hs01_00018657 predicted 1161
4 SASI_Hs01_00018658 predicted 677
5 SASI_Hs01_00018659 predicted 556
6 SASI_Hs02_00370520 predicted 685
7 SASI_Hs01_00018660 predicted 321
8 SASI_Hs01_00018662 predicted 588
9 SASI_Hs01_00018663 predicted 722
10 SASI_Hs02_00370521 predicted 335
11 SASI_Hs01_00018656 predicted 353
12 SASI_Hs01_00018661 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108722 predicted 1113
2 SASI_Rn01_00108723 predicted 1016
3 SASI_Rn01_00108727 predicted 1129
4 SASI_Rn01_00108728 predicted 788
5 SASI_Rn01_00108729 predicted 1109
6 SASI_Rn01_00108730 predicted 1083
7 SASI_Rn01_00108731 predicted 999
8 SASI_Rn02_00204111 predicted 1044
9 SASI_Rn02_00204112 predicted 1191
10 SASI_Rn02_00204113 predicted 626
11 SASI_Rn01_00108724 predicted 1139
12 SASI_Rn01_00108725 predicted 294
13 SASI_Rn01_00108726 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333693 predicted 311
2 SASI_Mm01_00176310 predicted 529
3 SASI_Mm02_00333694 predicted 631
4 SASI_Mm01_00176311 predicted 542
5 SASI_Mm02_00333695 predicted 406
6 SASI_Mm02_00333696 predicted 312
7 SASI_Mm02_00333697 predicted 298
8 SASI_Mm02_00333698 predicted 624
9 SASI_Mm02_00333699 predicted 658
10 SASI_Mm02_00333700 predicted 649
11 SASI_Mm01_00176309 predicted 261
12 SASI_Mm01_00176312 predicted 1060
13 SASI_Mm01_00176313 predicted 1179
14 SASI_Mm01_00176314 predicted 1037
15 SASI_Mm01_00176315 predicted 1284
16 SASI_Mm01_00176316 predicted 1188
17 SASI_Mm01_00176317 predicted 1187
18 SASI_Mm01_00176318 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031910
C1QTNF6 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-685s21c1
Sequence:CCGGAGGAGACGTACGTGCACATTACTCGAGTAATGTGCACGTACGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-329s21c1
Sequence:CCGGTGAGATCAGACCCTACATTAACTCGAGTTAATGTAGGGTCTGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-662s21c1
Sequence:CCGGCAATGTGCACAGCTGGAATTACTCGAGTAATTCCAGCTGTGCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031910.3-860s1c1
Sequence:CCGGCTTCGACACCTACATCACCTTCTCGAGAAGGTGATGTAGGTGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-854s1c1
Sequence:CCGGCAACGACTTCGACACCTACATCTCGAGATGTAGGTGTCGAAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-716s1c1
Sequence:CCGGGAAAGAGGCTGTCATCCTGTACTCGAGTACAGGATGACAGCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031910.3-695s1c1
Sequence:CCGGCGTGCACATTATGCATAACCACTCGAGTGGTTATGCATAATGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-573s1c1
Sequence:CCGGGAAAGGGTCTTTGTGAACCTTCTCGAGAAGGTTCACAAAGACCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-188s1c1
Sequence:CCGGGATGTGTGAGATCCCTATGGTCTCGAGACCATAGGGATCTCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031910.3-1167s1c1
Sequence:CCGGGCACTTCTCAAACTTGGAAATCTCGAGATTTCCAAGTTTGAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031910
C1QTNF6 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-685s21c1
Sequence:CCGGAGGAGACGTACGTGCACATTACTCGAGTAATGTGCACGTACGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-329s21c1
Sequence:CCGGTGAGATCAGACCCTACATTAACTCGAGTTAATGTAGGGTCTGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-662s21c1
Sequence:CCGGCAATGTGCACAGCTGGAATTACTCGAGTAATTCCAGCTGTGCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031910.3-860s1c1
Sequence:CCGGCTTCGACACCTACATCACCTTCTCGAGAAGGTGATGTAGGTGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-854s1c1
Sequence:CCGGCAACGACTTCGACACCTACATCTCGAGATGTAGGTGTCGAAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-716s1c1
Sequence:CCGGGAAAGAGGCTGTCATCCTGTACTCGAGTACAGGATGACAGCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031910.3-695s1c1
Sequence:CCGGCGTGCACATTATGCATAACCACTCGAGTGGTTATGCATAATGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-573s1c1
Sequence:CCGGGAAAGGGTCTTTGTGAACCTTCTCGAGAAGGTTCACAAAGACCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-188s1c1
Sequence:CCGGGATGTGTGAGATCCCTATGGTCTCGAGACCATAGGGATCTCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031910.3-1167s1c1
Sequence:CCGGGCACTTCTCAAACTTGGAAATCTCGAGATTTCCAAGTTTGAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031910
C1QTNF6 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-685s21c1
Sequence:CCGGAGGAGACGTACGTGCACATTACTCGAGTAATGTGCACGTACGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-329s21c1
Sequence:CCGGTGAGATCAGACCCTACATTAACTCGAGTTAATGTAGGGTCTGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031910.3-662s21c1
Sequence:CCGGCAATGTGCACAGCTGGAATTACTCGAGTAATTCCAGCTGTGCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031910.3-860s1c1
Sequence:CCGGCTTCGACACCTACATCACCTTCTCGAGAAGGTGATGTAGGTGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-854s1c1
Sequence:CCGGCAACGACTTCGACACCTACATCTCGAGATGTAGGTGTCGAAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-716s1c1
Sequence:CCGGGAAAGAGGCTGTCATCCTGTACTCGAGTACAGGATGACAGCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031910.3-695s1c1
Sequence:CCGGCGTGCACATTATGCATAACCACTCGAGTGGTTATGCATAATGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-573s1c1
Sequence:CCGGGAAAGGGTCTTTGTGAACCTTCTCGAGAAGGTTCACAAAGACCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031910.3-188s1c1
Sequence:CCGGGATGTGTGAGATCCCTATGGTCTCGAGACCATAGGGATCTCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031910.3-1167s1c1
Sequence:CCGGGCACTTCTCAAACTTGGAAATCTCGAGATTTCCAAGTTTGAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028331
VALIDATED
C1QTNF6 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000191640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-261s1c1
Sequence:CCGGGCCGTACATCAACATTACTATCTCGAGATAGTAATGTTGATGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-124s1c1
Sequence:CCGGGAGGAGACTACCTTTGGAGAACTCGAGTTCTCCAAAGGTAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028331.2-1806s1c1
Sequence:CCGGCCTGGGTTTATGAAGGTGCTTCTCGAGAAGCACCTTCATAAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-196s1c1
Sequence:CCGGGACCTGATGTCCTCTGATGATCTCGAGATCATCAGAGGACATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028331
VALIDATED
C1QTNF6 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000191640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-261s1c1
Sequence:CCGGGCCGTACATCAACATTACTATCTCGAGATAGTAATGTTGATGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-124s1c1
Sequence:CCGGGAGGAGACTACCTTTGGAGAACTCGAGTTCTCCAAAGGTAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028331.2-1806s1c1
Sequence:CCGGCCTGGGTTTATGAAGGTGCTTCTCGAGAAGCACCTTCATAAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-196s1c1
Sequence:CCGGGACCTGATGTCCTCTGATGATCTCGAGATCATCAGAGGACATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028331
VALIDATED
C1QTNF6 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000191640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-261s1c1
Sequence:CCGGGCCGTACATCAACATTACTATCTCGAGATAGTAATGTTGATGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-124s1c1
Sequence:CCGGGAGGAGACTACCTTTGGAGAACTCGAGTTCTCCAAAGGTAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028331.2-1806s1c1
Sequence:CCGGCCTGGGTTTATGAAGGTGCTTCTCGAGAAGCACCTTCATAAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028331.2-196s1c1
Sequence:CCGGGACCTGATGTCCTCTGATGATCTCGAGATCATCAGAGGACATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks