EMAIL THIS PAGE TO A FRIEND

C1QTNF7

C1q and tumor necrosis factor related protein 7

Synonyms: CTRP7 ZACRP7
UniProtKB ID: Q9BXJ2, B2RBT3, J3KPW3
Gene ID:
Mouse(109323) C1q and tumor necrosis factor related protein 7
Rat(305423) C1q and tumor necrosis factor related protein 7
chicken(422831) C1q and tumor necrosis factor related protein 7
cow(540131) C1q and tumor necrosis factor related protein 7
Horse(100055974) C1q and tumor necrosis factor related protein 7
domestic cat(101092852) C1q and tumor necrosis factor related protein 7
dog(609169) C1q and tumor necrosis factor related protein 7
domestic guinea pig(100733940) C1q and tumor necrosis factor related protein 7
naked mole-rat(101723099) C1q and tumor necrosis factor related protein 7
sheep(101105159) C1q and tumor necrosis factor related protein 7
Domestic Rabbit(100301536) C1q and tumor necrosis factor related protein 7
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043421 MISSION® esiRNA esiRNA human C1QTNF7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031911 Rosetta Predictions human pricing
NM_001107221 Rosetta Predictions rat pricing
NM_175425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179205 predicted 1020
2 SASI_Hs01_00179206 predicted 950
3 SASI_Hs01_00179207 predicted 705
4 SASI_Hs01_00179208 predicted 1101
5 SASI_Hs01_00179209 predicted 1087
6 SASI_Hs01_00179210 predicted 817
7 SASI_Hs01_00179211 predicted 1041
8 SASI_Hs01_00179212 predicted 934
9 SASI_Hs01_00179213 predicted 1063
10 SASI_Hs01_00179214 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226705 predicted 557
2 SASI_Rn02_00226706 predicted 720
3 SASI_Rn02_00226707 predicted 554
4 SASI_Rn02_00226708 predicted 597
5 SASI_Rn02_00226709 predicted 651
6 SASI_Rn02_00226710 predicted 478
7 SASI_Rn02_00226711 predicted 738
8 SASI_Rn02_00226712 predicted 672
9 SASI_Rn02_00226713 predicted 776
10 SASI_Rn02_00226714 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093592 predicted 465
2 SASI_Mm01_00093593 predicted 1214
3 SASI_Mm01_00093594 predicted 1286
4 SASI_Mm01_00093595 predicted 891
5 SASI_Mm01_00093596 predicted 991
6 SASI_Mm01_00093597 predicted 1008
7 SASI_Mm01_00093598 predicted 1420
8 SASI_Mm01_00093599 predicted 1422
9 SASI_Mm01_00093600 predicted 1057
10 SASI_Mm01_00093601 predicted 1423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031911
C1QTNF7 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-773s1c1
Sequence:CCGGCAGGGAAGTTCATCTGTGCTTCTCGAGAAGCACAGATGAACTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-316s1c1
Sequence:CCGGCCCAGGTATATCTGCAGCATTCTCGAGAATGCTGCAGATATACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031911.3-1658s1c1
Sequence:CCGGGCGCTGAATCAGATTTAATAACTCGAGTTATTAAATCTGATTCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-704s1c1
Sequence:CCGGCAGAAGAAAGACTACCTATTACTCGAGTAATAGGTAGTCTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-1058s1c1
Sequence:CCGGCAGATTACCTAGATTCCATATCTCGAGATATGGAATCTAGGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-703s1c1
Sequence:CCGGCCAGAAGAAAGACTACCTATTCTCGAGAATAGGTAGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-847s1c1
Sequence:CCGGGCAATCGGACTGGTACACAATCTCGAGATTGTGTACCAGTCCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031911.4-701s21c1
Sequence:CCGGTGATATCACATTGGCTAATAACTCGAGTTATTAGCCAATGTGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031911.4-1366s21c1
Sequence:CCGGCAATTCTCGAAAGGCTATATACTCGAGTATATAGCCTTTCGAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031911
C1QTNF7 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-773s1c1
Sequence:CCGGCAGGGAAGTTCATCTGTGCTTCTCGAGAAGCACAGATGAACTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-316s1c1
Sequence:CCGGCCCAGGTATATCTGCAGCATTCTCGAGAATGCTGCAGATATACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031911.3-1658s1c1
Sequence:CCGGGCGCTGAATCAGATTTAATAACTCGAGTTATTAAATCTGATTCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-704s1c1
Sequence:CCGGCAGAAGAAAGACTACCTATTACTCGAGTAATAGGTAGTCTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-1058s1c1
Sequence:CCGGCAGATTACCTAGATTCCATATCTCGAGATATGGAATCTAGGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-703s1c1
Sequence:CCGGCCAGAAGAAAGACTACCTATTCTCGAGAATAGGTAGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-847s1c1
Sequence:CCGGGCAATCGGACTGGTACACAATCTCGAGATTGTGTACCAGTCCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031911.4-701s21c1
Sequence:CCGGTGATATCACATTGGCTAATAACTCGAGTTATTAGCCAATGTGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031911.4-1366s21c1
Sequence:CCGGCAATTCTCGAAAGGCTATATACTCGAGTATATAGCCTTTCGAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031911
C1QTNF7 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-773s1c1
Sequence:CCGGCAGGGAAGTTCATCTGTGCTTCTCGAGAAGCACAGATGAACTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-316s1c1
Sequence:CCGGCCCAGGTATATCTGCAGCATTCTCGAGAATGCTGCAGATATACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031911.3-1658s1c1
Sequence:CCGGGCGCTGAATCAGATTTAATAACTCGAGTTATTAAATCTGATTCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-704s1c1
Sequence:CCGGCAGAAGAAAGACTACCTATTACTCGAGTAATAGGTAGTCTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-1058s1c1
Sequence:CCGGCAGATTACCTAGATTCCATATCTCGAGATATGGAATCTAGGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-703s1c1
Sequence:CCGGCCAGAAGAAAGACTACCTATTCTCGAGAATAGGTAGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031911.3-847s1c1
Sequence:CCGGGCAATCGGACTGGTACACAATCTCGAGATTGTGTACCAGTCCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031911.4-701s21c1
Sequence:CCGGTGATATCACATTGGCTAATAACTCGAGTTATTAGCCAATGTGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031911.4-1366s21c1
Sequence:CCGGCAATTCTCGAAAGGCTATATACTCGAGTATATAGCCTTTCGAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175425
C1QTNF7 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175425.3-1489s1c1
Sequence:CCGGCCCTAAAGTAATGATCCTAAACTCGAGTTTAGGATCATTACTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-881s1c1
Sequence:CCGGCCCAGAAGAAAGACTACCCATCTCGAGATGGGTAGTCTTTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-1200s1c1
Sequence:CCGGGACAGCTTGTTCTCTGGGTTTCTCGAGAAACCCAGAGAACAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-482s1c1
Sequence:CCGGAGAGAGCTACTCTCCAAGGTACTCGAGTACCTTGGAGAGTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-1221s1c1
Sequence:CCGGCTCCTCTATGTCGATACAGATCTCGAGATCTGTATCGACATAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175425
C1QTNF7 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175425.3-1489s1c1
Sequence:CCGGCCCTAAAGTAATGATCCTAAACTCGAGTTTAGGATCATTACTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-881s1c1
Sequence:CCGGCCCAGAAGAAAGACTACCCATCTCGAGATGGGTAGTCTTTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-1200s1c1
Sequence:CCGGGACAGCTTGTTCTCTGGGTTTCTCGAGAAACCCAGAGAACAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-482s1c1
Sequence:CCGGAGAGAGCTACTCTCCAAGGTACTCGAGTACCTTGGAGAGTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-1221s1c1
Sequence:CCGGCTCCTCTATGTCGATACAGATCTCGAGATCTGTATCGACATAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175425
C1QTNF7 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175425.3-1489s1c1
Sequence:CCGGCCCTAAAGTAATGATCCTAAACTCGAGTTTAGGATCATTACTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-881s1c1
Sequence:CCGGCCCAGAAGAAAGACTACCCATCTCGAGATGGGTAGTCTTTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-1200s1c1
Sequence:CCGGGACAGCTTGTTCTCTGGGTTTCTCGAGAAACCCAGAGAACAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-482s1c1
Sequence:CCGGAGAGAGCTACTCTCCAAGGTACTCGAGTACCTTGGAGAGTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175425.3-1221s1c1
Sequence:CCGGCTCCTCTATGTCGATACAGATCTCGAGATCTGTATCGACATAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks