EMAIL THIS PAGE TO A FRIEND

C1QTNF8

C1q and tumor necrosis factor related protein 8

17 Gene Product Result for
Synonyms: CTRP8 UNQ5829
UniProtKB ID: P60827, B7U178
Gene ID:
chicken(427666) C1q and tumor necrosis factor related protein 8
cow(524646) C1q and tumor necrosis factor related protein 8
domestic cat(101086277) C1q and tumor necrosis factor related protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207419 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174299 predicted 450
2 SASI_Hs01_00174300 predicted 1268
3 SASI_Hs01_00174301 predicted 377
4 SASI_Hs01_00174302 predicted 447
5 SASI_Hs01_00174303 predicted 1437
6 SASI_Hs01_00174304 predicted 1490
7 SASI_Hs01_00174305 predicted 454
8 SASI_Hs01_00174306 predicted 968
9 SASI_Hs01_00174307 predicted 441
10 SASI_Hs01_00174308 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207419
C1QTNF8 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207419.3-1494s21c1
Sequence:CCGGGGAAGTGTGGTGACAACCAAGCTCGAGCTTGGTTGTCACCACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207419.3-792s21c1
Sequence:CCGGGGAACTACAAGGAGACCTACCCTCGAGGGTAGGTCTCCTTGTAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207419.3-1443s21c1
Sequence:CCGGGTACTCAAGTCCCACCTTGTGCTCGAGCACAAGGTGGGACTTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-823s1c1
Sequence:CCGGGAACTACAAGGAGACCTACCTCTCGAGAGGTAGGTCTCCTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-470s1c1
Sequence:CCGGGAAATCCTCAAAGGTGAGAAGCTCGAGCTTCTCACCTTTGAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2634s1c1
Sequence:CCGGGAGATAAGATACGGTCACGATCTCGAGATCGTGACCGTATCTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-469s1c1
Sequence:CCGGCGAAATCCTCAAAGGTGAGAACTCGAGTTCTCACCTTTGAGGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2587s1c1
Sequence:CCGGCCTTCCAGGTTTATTTGTTTACTCGAGTAAACAAATAAACCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2623s1c1
Sequence:CCGGGAACTGAAAGTGAGATAAGATCTCGAGATCTTATCTCACTTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207419
C1QTNF8 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207419.3-1494s21c1
Sequence:CCGGGGAAGTGTGGTGACAACCAAGCTCGAGCTTGGTTGTCACCACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207419.3-792s21c1
Sequence:CCGGGGAACTACAAGGAGACCTACCCTCGAGGGTAGGTCTCCTTGTAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207419.3-1443s21c1
Sequence:CCGGGTACTCAAGTCCCACCTTGTGCTCGAGCACAAGGTGGGACTTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-823s1c1
Sequence:CCGGGAACTACAAGGAGACCTACCTCTCGAGAGGTAGGTCTCCTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-470s1c1
Sequence:CCGGGAAATCCTCAAAGGTGAGAAGCTCGAGCTTCTCACCTTTGAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2634s1c1
Sequence:CCGGGAGATAAGATACGGTCACGATCTCGAGATCGTGACCGTATCTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-469s1c1
Sequence:CCGGCGAAATCCTCAAAGGTGAGAACTCGAGTTCTCACCTTTGAGGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2587s1c1
Sequence:CCGGCCTTCCAGGTTTATTTGTTTACTCGAGTAAACAAATAAACCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2623s1c1
Sequence:CCGGGAACTGAAAGTGAGATAAGATCTCGAGATCTTATCTCACTTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207419
C1QTNF8 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207419.3-1494s21c1
Sequence:CCGGGGAAGTGTGGTGACAACCAAGCTCGAGCTTGGTTGTCACCACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207419.3-792s21c1
Sequence:CCGGGGAACTACAAGGAGACCTACCCTCGAGGGTAGGTCTCCTTGTAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207419.3-1443s21c1
Sequence:CCGGGTACTCAAGTCCCACCTTGTGCTCGAGCACAAGGTGGGACTTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-823s1c1
Sequence:CCGGGAACTACAAGGAGACCTACCTCTCGAGAGGTAGGTCTCCTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-470s1c1
Sequence:CCGGGAAATCCTCAAAGGTGAGAAGCTCGAGCTTCTCACCTTTGAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2634s1c1
Sequence:CCGGGAGATAAGATACGGTCACGATCTCGAGATCGTGACCGTATCTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207419.1-469s1c1
Sequence:CCGGCGAAATCCTCAAAGGTGAGAACTCGAGTTCTCACCTTTGAGGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2587s1c1
Sequence:CCGGCCTTCCAGGTTTATTTGTTTACTCGAGTAAACAAATAAACCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207419.1-2623s1c1
Sequence:CCGGGAACTGAAAGTGAGATAAGATCTCGAGATCTTATCTCACTTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks