EMAIL THIS PAGE TO A FRIEND

C1QTNF9

C1q and tumor necrosis factor related protein 9

65 Gene Product Result for
Synonyms: AQL1 C1QTNF9A CTRP9
UniProtKB ID: P0C862, A2A3T6, Q0VGC5, Q5VX65, Q5VX66, Q8IUU4
Gene ID:
Mouse(239126) C1q and tumor necrosis factor related protein 9
Rat(364395) C1q and tumor necrosis factor related protein 9
Zebrafish(799425) C1q and tumor necrosis factor related protein 9
chicken(771538) C1q and tumor necrosis factor related protein 9
cow(523616) C1q and tumor necrosis factor related protein 9
domestic cat(101095540) C1q and tumor necrosis factor related protein 9
dog(609026) C1q and tumor necrosis factor related protein 9
domestic guinea pig(100717408) C1q and tumor necrosis factor related protein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302884 ANTI-C1QTNF9 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1400862 Anti-C1QTNF9 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178540 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178540 Rosetta Predictions human pricing
XM_001063239 Rosetta Predictions rat pricing
XM_344414 Rosetta Predictions rat pricing
NM_183175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040239 predicted 1245
2 SASI_Hs01_00040240 predicted 739
3 SASI_Hs01_00040241 predicted 713
4 SASI_Hs01_00040242 predicted 1096
5 SASI_Hs02_00369776 predicted 1277
6 SASI_Hs01_00040243 predicted 837
7 SASI_Hs01_00040244 predicted 922
8 SASI_Hs01_00040245 predicted 687
9 SASI_Hs01_00040246 predicted 313
10 SASI_Hs01_00040247 predicted 692
11 SASI_Hs01_00040248 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306357 predicted 477
2 SASI_Rn02_00306358 predicted 1130
3 SASI_Rn02_00306359 predicted 602
4 SASI_Rn02_00306360 predicted 854
5 SASI_Rn02_00306361 predicted 859
6 SASI_Rn02_00306362 predicted 990
7 SASI_Rn02_00306363 predicted 870
8 SASI_Rn02_00306364 predicted 984
9 SASI_Rn02_00306365 predicted 940
10 SASI_Rn02_00306366 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397061 predicted 317
2 SASI_Rn02_00397062 predicted 971
3 SASI_Rn02_00397063 predicted 435
4 SASI_Rn02_00397064 predicted 693
5 SASI_Rn02_00397065 predicted 697
6 SASI_Rn02_00397066 predicted 826
7 SASI_Rn02_00397067 predicted 707
8 SASI_Rn02_00397068 predicted 819
9 SASI_Rn02_00397069 predicted 785
10 SASI_Rn02_00397070 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350274 predicted 710
2 SASI_Mm02_00350275 predicted 1216
3 SASI_Mm02_00350276 predicted 718
4 SASI_Mm02_00350277 predicted 832
5 SASI_Mm02_00350278 predicted 713
6 SASI_Mm02_00350279 predicted 793
7 SASI_Mm02_00350280 predicted 794
8 SASI_Mm02_00350281 predicted 1301
9 SASI_Mm02_00350282 predicted 1233
10 SASI_Mm02_00350283 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183175
C1QTNF9 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 9
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183175.2-1218s1c1
Sequence:CCGGCCGTCATTTGAACACATGAATCTCGAGATTCATGTGTTCAAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-731s1c1
Sequence:CCGGGATCCTATACAATGAACTGAACTCGAGTTCAGTTCATTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-146s1c1
Sequence:CCGGCCCTGGGAATCCAGGTCACAACTCGAGTTGTGACCTGGATTCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-981s1c1
Sequence:CCGGGAGAGGTTCAATGGCTTATTTCTCGAGAAATAAGCCATTGAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183175.3-675s21c1
Sequence:CCGGGGACTCACGGTGATCAGTAAGCTCGAGCTTACTGATCACCGTGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183175.3-89s21c1
Sequence:CCGGTGCATGCACGAGAAGTGTATTCTCGAGAATACACTTCTCGTGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183175
C1QTNF9 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 9
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183175.2-1218s1c1
Sequence:CCGGCCGTCATTTGAACACATGAATCTCGAGATTCATGTGTTCAAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-731s1c1
Sequence:CCGGGATCCTATACAATGAACTGAACTCGAGTTCAGTTCATTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-146s1c1
Sequence:CCGGCCCTGGGAATCCAGGTCACAACTCGAGTTGTGACCTGGATTCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-981s1c1
Sequence:CCGGGAGAGGTTCAATGGCTTATTTCTCGAGAAATAAGCCATTGAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183175.3-675s21c1
Sequence:CCGGGGACTCACGGTGATCAGTAAGCTCGAGCTTACTGATCACCGTGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183175.3-89s21c1
Sequence:CCGGTGCATGCACGAGAAGTGTATTCTCGAGAATACACTTCTCGTGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183175
C1QTNF9 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 9
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183175.2-1218s1c1
Sequence:CCGGCCGTCATTTGAACACATGAATCTCGAGATTCATGTGTTCAAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-731s1c1
Sequence:CCGGGATCCTATACAATGAACTGAACTCGAGTTCAGTTCATTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-146s1c1
Sequence:CCGGCCCTGGGAATCCAGGTCACAACTCGAGTTGTGACCTGGATTCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183175.2-981s1c1
Sequence:CCGGGAGAGGTTCAATGGCTTATTTCTCGAGAAATAAGCCATTGAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183175.3-675s21c1
Sequence:CCGGGGACTCACGGTGATCAGTAAGCTCGAGCTTACTGATCACCGTGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183175.3-89s21c1
Sequence:CCGGTGCATGCACGAGAAGTGTATTCTCGAGAATACACTTCTCGTGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178540
C1QTNF9 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-92s1c1
Sequence:CCGGGAAATCTGCACAGGGAACATACTCGAGTATGTTCCCTGTGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-986s1c1
Sequence:CCGGGAGAGGTTCAATGGCTTGTTTCTCGAGAAACAAGCCATTGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-888s1c1
Sequence:CCGGCCAAAGATGCTTACATGAGCTCTCGAGAGCTCATGTAAGCATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-100s1c1
Sequence:CCGGCACAGGGAACATAAACTCACACTCGAGTGTGAGTTTATGTTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178540.2-708s1c1
Sequence:CCGGCTTCAGATGTGCCCATTAAATCTCGAGATTTAATGGGCACATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178540.2-805s1c1
Sequence:CCGGCTATTACTTCACCTACCACATCTCGAGATGTGGTAGGTGAAGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-883s1c1
Sequence:CCGGGCACACCAAAGATGCTTACATCTCGAGATGTAAGCATCTTTGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178540.3-1354s21c1
Sequence:CCGGTAGTGCTCTGAGGAGTCATATCTCGAGATATGACTCCTCAGAGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178540.3-1105s21c1
Sequence:CCGGCAGCTTGGGATGAACTTATTCCTCGAGGAATAAGTTCATCCCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178540.3-1058s21c1
Sequence:CCGGCCGTGACAGAGGAGAGTTTAACTCGAGTTAAACTCTCCTCTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178540
C1QTNF9 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-92s1c1
Sequence:CCGGGAAATCTGCACAGGGAACATACTCGAGTATGTTCCCTGTGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-986s1c1
Sequence:CCGGGAGAGGTTCAATGGCTTGTTTCTCGAGAAACAAGCCATTGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-888s1c1
Sequence:CCGGCCAAAGATGCTTACATGAGCTCTCGAGAGCTCATGTAAGCATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-100s1c1
Sequence:CCGGCACAGGGAACATAAACTCACACTCGAGTGTGAGTTTATGTTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178540.2-708s1c1
Sequence:CCGGCTTCAGATGTGCCCATTAAATCTCGAGATTTAATGGGCACATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178540.2-805s1c1
Sequence:CCGGCTATTACTTCACCTACCACATCTCGAGATGTGGTAGGTGAAGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-883s1c1
Sequence:CCGGGCACACCAAAGATGCTTACATCTCGAGATGTAAGCATCTTTGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178540.3-1354s21c1
Sequence:CCGGTAGTGCTCTGAGGAGTCATATCTCGAGATATGACTCCTCAGAGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178540.3-1105s21c1
Sequence:CCGGCAGCTTGGGATGAACTTATTCCTCGAGGAATAAGTTCATCCCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178540.3-1058s21c1
Sequence:CCGGCCGTGACAGAGGAGAGTTTAACTCGAGTTAAACTCTCCTCTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178540
C1QTNF9 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-92s1c1
Sequence:CCGGGAAATCTGCACAGGGAACATACTCGAGTATGTTCCCTGTGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-986s1c1
Sequence:CCGGGAGAGGTTCAATGGCTTGTTTCTCGAGAAACAAGCCATTGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-888s1c1
Sequence:CCGGCCAAAGATGCTTACATGAGCTCTCGAGAGCTCATGTAAGCATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-100s1c1
Sequence:CCGGCACAGGGAACATAAACTCACACTCGAGTGTGAGTTTATGTTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178540.2-708s1c1
Sequence:CCGGCTTCAGATGTGCCCATTAAATCTCGAGATTTAATGGGCACATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178540.2-805s1c1
Sequence:CCGGCTATTACTTCACCTACCACATCTCGAGATGTGGTAGGTGAAGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178540.2-883s1c1
Sequence:CCGGGCACACCAAAGATGCTTACATCTCGAGATGTAAGCATCTTTGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178540.3-1354s21c1
Sequence:CCGGTAGTGCTCTGAGGAGTCATATCTCGAGATATGACTCCTCAGAGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178540.3-1105s21c1
Sequence:CCGGCAGCTTGGGATGAACTTATTCCTCGAGGAATAAGTTCATCCCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178540.3-1058s21c1
Sequence:CCGGCCGTGACAGAGGAGAGTTTAACTCGAGTTAAACTCTCCTCTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks