EMAIL THIS PAGE TO A FRIEND

C1QTNF9B-AS1

C1QTNF9B antisense RNA 1

21 Gene Product Result for
Synonyms: PCOTH
Gene ID:
Rat(100362042) C1QTNF9B antisense RNA 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014442 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118081 MISSION® esiRNA esiRNA human AL445985.10-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014442 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181312 predicted 389
2 SASI_Hs01_00181313 predicted 497
3 SASI_Hs01_00181314 predicted 426
4 SASI_Hs01_00181315 predicted 397
5 SASI_Hs01_00181316 predicted 393
6 SASI_Hs01_00181317 predicted 431
7 SASI_Hs01_00181318 predicted 386
8 SASI_Hs01_00181319 predicted 429
9 SASI_Hs01_00181311 predicted 411
10 SASI_Hs01_00181320 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014442
C1QTNF9B-AS1 MISSION shRNA Bacterial Glycerol Stock
C1QTNF9B antisense RNA 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-541s21c1
Sequence:CCGGGTAAACCAGTTGGGCCCAAAGCTCGAGCTTTGGGCCCAACTGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-435s21c1
Sequence:CCGGTCTCCTTTCCAGCCTCTTATTCTCGAGAATAAGAGGCTGGAAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-503s21c1
Sequence:CCGGCTTGGGACCAGGCTTTCCAATCTCGAGATTGGAAAGCCTGGTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-397s21c1
Sequence:CCGGAGACTAGAGTCTCACCGATTTCTCGAGAAATCGGTGAGACTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-596s21c1
Sequence:CCGGGGGACCCACGTCACCCTTATTCTCGAGAATAAGGGTGACGTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014442
C1QTNF9B-AS1 MISSION shRNA shRNA Plasmid DNA
C1QTNF9B antisense RNA 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-541s21c1
Sequence:CCGGGTAAACCAGTTGGGCCCAAAGCTCGAGCTTTGGGCCCAACTGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-435s21c1
Sequence:CCGGTCTCCTTTCCAGCCTCTTATTCTCGAGAATAAGAGGCTGGAAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-503s21c1
Sequence:CCGGCTTGGGACCAGGCTTTCCAATCTCGAGATTGGAAAGCCTGGTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-397s21c1
Sequence:CCGGAGACTAGAGTCTCACCGATTTCTCGAGAAATCGGTGAGACTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-596s21c1
Sequence:CCGGGGGACCCACGTCACCCTTATTCTCGAGAATAAGGGTGACGTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014442
C1QTNF9B-AS1 MISSION shRNA Lentiviral Transduction Particles
C1QTNF9B antisense RNA 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-541s21c1
Sequence:CCGGGTAAACCAGTTGGGCCCAAAGCTCGAGCTTTGGGCCCAACTGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-435s21c1
Sequence:CCGGTCTCCTTTCCAGCCTCTTATTCTCGAGAATAAGAGGCTGGAAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-503s21c1
Sequence:CCGGCTTGGGACCAGGCTTTCCAATCTCGAGATTGGAAAGCCTGGTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-397s21c1
Sequence:CCGGAGACTAGAGTCTCACCGATTTCTCGAGAAATCGGTGAGACTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014442.2-596s21c1
Sequence:CCGGGGGACCCACGTCACCCTTATTCTCGAGAATAAGGGTGACGTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks