EMAIL THIS PAGE TO A FRIEND

C1QTNF9B

C1q and tumor necrosis factor related protein 9B

Synonyms: CTRP9B
Species: Human C1QTNF9B(387911)
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056632 Anti-C1QTNF9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007537 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007537 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032449 predicted 690
2 SASI_Hs01_00032451 predicted 632
3 SASI_Hs01_00032452 predicted 647
4 SASI_Hs01_00032453 predicted 778
5 SASI_Hs01_00032454 predicted 649
6 SASI_Hs01_00032455 predicted 637
7 SASI_Hs01_00032456 predicted 770
8 SASI_Hs01_00032457 predicted 221
9 SASI_Hs02_00305333 predicted 253
10 SASI_Hs01_00032458 predicted 580
11 SASI_Hs01_00032450 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007537
C1QTNF9B MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 9B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007537.1-716s21c1
Sequence:CCGGGGAAATTCACGTGCCACATTGCTCGAGCAATGTGGCACGTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-652s1c1
Sequence:CCGGGATGTGCCCATTAAATTTGATCTCGAGATCAAATTTAATGGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-777s1c1
Sequence:CCGGCAGGAATGTTCAGGTGTCTTTCTCGAGAAAGACACCTGAACATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-27s1c1
Sequence:CCGGCATTGAAATCTGCACAGGGAACTCGAGTTCCCTGTGCAGATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-549s1c1
Sequence:CCGGGAAAGGAGATCGAGGAGAGAACTCGAGTTCTCTCCTCGATCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007537
C1QTNF9B MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 9B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007537.1-716s21c1
Sequence:CCGGGGAAATTCACGTGCCACATTGCTCGAGCAATGTGGCACGTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-652s1c1
Sequence:CCGGGATGTGCCCATTAAATTTGATCTCGAGATCAAATTTAATGGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-777s1c1
Sequence:CCGGCAGGAATGTTCAGGTGTCTTTCTCGAGAAAGACACCTGAACATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-27s1c1
Sequence:CCGGCATTGAAATCTGCACAGGGAACTCGAGTTCCCTGTGCAGATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-549s1c1
Sequence:CCGGGAAAGGAGATCGAGGAGAGAACTCGAGTTCTCTCCTCGATCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007537
C1QTNF9B MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 9B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007537.1-716s21c1
Sequence:CCGGGGAAATTCACGTGCCACATTGCTCGAGCAATGTGGCACGTGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-652s1c1
Sequence:CCGGGATGTGCCCATTAAATTTGATCTCGAGATCAAATTTAATGGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-777s1c1
Sequence:CCGGCAGGAATGTTCAGGTGTCTTTCTCGAGAAAGACACCTGAACATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-27s1c1
Sequence:CCGGCATTGAAATCTGCACAGGGAACTCGAGTTCCCTGTGCAGATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007537.1-549s1c1
Sequence:CCGGGAAAGGAGATCGAGGAGAGAACTCGAGTTCTCTCCTCGATCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks