EMAIL THIS PAGE TO A FRIEND

C1R

complement component 1, r subcomponent

44 Gene Product Result for
UniProtKB ID: P00736, A6NJQ8, Q68D77, Q8J012
Gene ID:
Rat(312705) complement component 1, r subcomponent
domestic guinea pig(100733374) complement component 1, r subcomponent
naked mole-rat(101717538) complement component 1, r subcomponent
sheep(101107430) complement component 1, r subcomponent
Domestic Rabbit(100009351) complement component 1, r subcomponent
Zebrafish(560927) complement component 1, r subcomponent
dog(477707) complement component 1, r subcomponent
domestic cat(101088940) complement component 1, r subcomponent
cow(511581) complement component 1, r subcomponent
Horse(100060297) complement component 1, r subcomponent
chicken(418295) complement component 1, r subcomponent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1295 Human C1R ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001733 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077231 MISSION® esiRNA esiRNA human AC140077.17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001733 Rosetta Predictions human pricing
NM_001134555 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013451 predicted 1245
2 SASI_Hs01_00013454 predicted 263
3 SASI_Hs01_00013455 predicted 1204
4 SASI_Hs01_00013457 predicted 488
5 SASI_Hs01_00013459 predicted 402
6 SASI_Hs01_00013460 predicted 208
7 SASI_Hs02_00332439 predicted 360
8 SASI_Hs02_00332440 predicted 824
9 SASI_Hs02_00332441 predicted 277
10 SASI_Hs02_00332442 predicted 463
11 SASI_Hs01_00013452 predicted 1266
12 SASI_Hs01_00013453 predicted 1040
13 SASI_Hs01_00013456 predicted 1941
14 SASI_Hs01_00013458 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257039 predicted 1903
2 SASI_Rn02_00257040 predicted 290
3 SASI_Rn02_00257041 predicted 843
4 SASI_Rn02_00257042 predicted 1055
5 SASI_Rn02_00257043 predicted 1830
6 SASI_Rn02_00257044 predicted 1725
7 SASI_Rn02_00257045 predicted 851
8 SASI_Rn02_00257046 predicted 1259
9 SASI_Rn02_00257047 predicted 379
10 SASI_Rn02_00257048 predicted 1842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001733
VALIDATED
C1R MISSION shRNA Bacterial Glycerol Stock
complement component 1, r subcomponent
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001733.4-356s21c1
Sequence:CCGGCCCGGGAAAGAAGGAATTTATCTCGAGATAAATTCCTTCTTTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001733.4-2257s21c1
Sequence:CCGGCCACTAAGAGTCTCTATTAAACTCGAGTTTAATAGAGACTCTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001733.4-1700s21c1
Sequence:CCGGTCAGGATGAGTCCTACAATTTCTCGAGAAATTGTAGGACTCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001733.4-1271s21c1
Sequence:CCGGCTACTGCCATGAGCCATATTACTCGAGTAATATGGCTCATGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001733.x-655s1c1
Sequence:CCGGCGGAGGCATCAGGCTACATCTCTCGAGAGATGTAGCCTGATGCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001733.x-959s1c1
Sequence:CCGGGCGCTACACCACCGAGATCATCTCGAGATGATCTCGGTGGTGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001733.x-481s1c1
Sequence:CCGGTGGACCTTGATGAATGTGCTTCTCGAGAAGCACATTCATCAAGGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001733.x-2421s1c1
Sequence:CCGGCTCTTCCACTTTGATACCATTCTCGAGAATGGTATCAAAGTGGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001733.x-1001s1c1
Sequence:CCGGCCTAGACGAGTTCACCATCATCTCGAGATGATGGTGAACTCGTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001733
VALIDATED
C1R MISSION shRNA shRNA Plasmid DNA
complement component 1, r subcomponent
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001733.4-356s21c1
Sequence:CCGGCCCGGGAAAGAAGGAATTTATCTCGAGATAAATTCCTTCTTTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001733.4-2257s21c1
Sequence:CCGGCCACTAAGAGTCTCTATTAAACTCGAGTTTAATAGAGACTCTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001733.4-1700s21c1
Sequence:CCGGTCAGGATGAGTCCTACAATTTCTCGAGAAATTGTAGGACTCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001733.4-1271s21c1
Sequence:CCGGCTACTGCCATGAGCCATATTACTCGAGTAATATGGCTCATGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001733.x-655s1c1
Sequence:CCGGCGGAGGCATCAGGCTACATCTCTCGAGAGATGTAGCCTGATGCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001733.x-959s1c1
Sequence:CCGGGCGCTACACCACCGAGATCATCTCGAGATGATCTCGGTGGTGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001733.x-481s1c1
Sequence:CCGGTGGACCTTGATGAATGTGCTTCTCGAGAAGCACATTCATCAAGGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001733.x-2421s1c1
Sequence:CCGGCTCTTCCACTTTGATACCATTCTCGAGAATGGTATCAAAGTGGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001733.x-1001s1c1
Sequence:CCGGCCTAGACGAGTTCACCATCATCTCGAGATGATGGTGAACTCGTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001733
VALIDATED
C1R MISSION shRNA Lentiviral Transduction Particles
complement component 1, r subcomponent
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001733.4-356s21c1
Sequence:CCGGCCCGGGAAAGAAGGAATTTATCTCGAGATAAATTCCTTCTTTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001733.4-2257s21c1
Sequence:CCGGCCACTAAGAGTCTCTATTAAACTCGAGTTTAATAGAGACTCTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001733.4-1700s21c1
Sequence:CCGGTCAGGATGAGTCCTACAATTTCTCGAGAAATTGTAGGACTCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001733.4-1271s21c1
Sequence:CCGGCTACTGCCATGAGCCATATTACTCGAGTAATATGGCTCATGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001733.x-655s1c1
Sequence:CCGGCGGAGGCATCAGGCTACATCTCTCGAGAGATGTAGCCTGATGCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001733.x-959s1c1
Sequence:CCGGGCGCTACACCACCGAGATCATCTCGAGATGATCTCGGTGGTGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001733.x-481s1c1
Sequence:CCGGTGGACCTTGATGAATGTGCTTCTCGAGAAGCACATTCATCAAGGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001733.x-2421s1c1
Sequence:CCGGCTCTTCCACTTTGATACCATTCTCGAGAATGGTATCAAAGTGGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001733.x-1001s1c1
Sequence:CCGGCCTAGACGAGTTCACCATCATCTCGAGATGATGGTGAACTCGTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks