EMAIL THIS PAGE TO A FRIEND

C1RL

complement component 1, r subcomponent-like

55 Gene Product Result for
Synonyms: C1RL1 C1RLP C1r-LP CLSPa
UniProtKB ID: Q9NZP8, Q53GX9
Gene ID:
Mouse(232371) complement component 1, r subcomponent-like
Rat(408246) complement component 1, r subcomponent-like
naked mole-rat(101728375) complement component 1, r subcomponent-like
domestic guinea pig(100722042) complement component 1, r subcomponent-like
Domestic Rabbit(100349147) complement component 1, r subcomponent-like
domestic cat(101094109) complement component 1, r subcomponent-like
cow(507633) complement component 1, r subcomponent-like
dog(486713) complement component 1, r subcomponent-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043001 MISSION® esiRNA esiRNA human C1RL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016546 Rosetta Predictions human pricing
NM_001002804 Rosetta Predictions rat pricing
NM_181344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195643 predicted 381
2 SASI_Hs01_00195644 predicted 1004
3 SASI_Hs01_00195645 predicted 1097
4 SASI_Hs01_00195646 predicted 495
5 SASI_Hs01_00195647 predicted 1326
6 SASI_Hs01_00195648 predicted 236
7 SASI_Hs02_00349663 predicted 436
8 SASI_Hs01_00195651 predicted 318
9 SASI_Hs02_00349664 predicted 241
10 SASI_Hs01_00195652 predicted 960
11 SASI_Hs01_00195649 predicted 1165
12 SASI_Hs01_00195650 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115531 predicted 308
2 SASI_Rn01_00115532 predicted 291
3 SASI_Rn01_00115533 predicted 347
4 SASI_Rn01_00115534 predicted 488
5 SASI_Rn01_00115535 predicted 1052
6 SASI_Rn01_00115536 predicted 985
7 SASI_Rn01_00115538 predicted 530
8 SASI_Rn01_00115539 predicted 1034
9 SASI_Rn01_00115540 predicted 298
10 SASI_Rn02_00197987 predicted 1047
11 SASI_Rn01_00115537 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349708 predicted 1437
2 SASI_Mm02_00349709 predicted 995
3 SASI_Mm02_00349710 predicted 1416
4 SASI_Mm02_00349711 predicted 271
5 SASI_Mm02_00349712 predicted 1425
6 SASI_Mm02_00349713 predicted 1394
7 SASI_Mm02_00349714 predicted 1243
8 SASI_Mm02_00349715 predicted 1965
9 SASI_Mm02_00349716 predicted 716
10 SASI_Mm02_00349717 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016546
C1RL MISSION shRNA Bacterial Glycerol Stock
complement component 1, r subcomponent-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-674s21c1
Sequence:CCCGACTGCCAGGAGCCCTATTATCCTCGAGGATAATAGGGCTCCTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016546.2-2030s21c1
Sequence:CCGGTGCAGCTCCAAGATGCAATTACTCGAGTAATTGCATCTTGGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-1082s21c1
Sequence:CCGGAGAATGAGTCCCATAACTTTACTCGAGTAAAGTTATGGGACTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-382s21c1
Sequence:CCGGGACTCTGTCACAATCTCATTCCTCGAGGAATGAGATTGTGACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016546.1-1892s1c1
Sequence:CCGGGCATTGCATTTCTGAAACATTCTCGAGAATGTTTCAGAAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-905s1c1
Sequence:CCGGCCAGAGTGTGAATGTGTTCTTCTCGAGAAGAACACATTCACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-936s1c1
Sequence:CCGGGCCATAGATGAGATGCTGAAACTCGAGTTTCAGCATCTCATCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-902s1c1
Sequence:CCGGGAACCAGAGTGTGAATGTGTTCTCGAGAACACATTCACACTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-1166s1c1
Sequence:CCGGCTGGCTAACTACTGAGCTGAACTCGAGTTCAGCTCAGTAGTTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016546
C1RL MISSION shRNA shRNA Plasmid DNA
complement component 1, r subcomponent-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-674s21c1
Sequence:CCCGACTGCCAGGAGCCCTATTATCCTCGAGGATAATAGGGCTCCTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016546.2-2030s21c1
Sequence:CCGGTGCAGCTCCAAGATGCAATTACTCGAGTAATTGCATCTTGGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-1082s21c1
Sequence:CCGGAGAATGAGTCCCATAACTTTACTCGAGTAAAGTTATGGGACTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-382s21c1
Sequence:CCGGGACTCTGTCACAATCTCATTCCTCGAGGAATGAGATTGTGACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016546.1-1892s1c1
Sequence:CCGGGCATTGCATTTCTGAAACATTCTCGAGAATGTTTCAGAAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-905s1c1
Sequence:CCGGCCAGAGTGTGAATGTGTTCTTCTCGAGAAGAACACATTCACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-936s1c1
Sequence:CCGGGCCATAGATGAGATGCTGAAACTCGAGTTTCAGCATCTCATCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-902s1c1
Sequence:CCGGGAACCAGAGTGTGAATGTGTTCTCGAGAACACATTCACACTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-1166s1c1
Sequence:CCGGCTGGCTAACTACTGAGCTGAACTCGAGTTCAGCTCAGTAGTTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016546
C1RL MISSION shRNA Lentiviral Transduction Particles
complement component 1, r subcomponent-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-674s21c1
Sequence:CCCGACTGCCAGGAGCCCTATTATCCTCGAGGATAATAGGGCTCCTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016546.2-2030s21c1
Sequence:CCGGTGCAGCTCCAAGATGCAATTACTCGAGTAATTGCATCTTGGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-1082s21c1
Sequence:CCGGAGAATGAGTCCCATAACTTTACTCGAGTAAAGTTATGGGACTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016546.2-382s21c1
Sequence:CCGGGACTCTGTCACAATCTCATTCCTCGAGGAATGAGATTGTGACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016546.1-1892s1c1
Sequence:CCGGGCATTGCATTTCTGAAACATTCTCGAGAATGTTTCAGAAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-905s1c1
Sequence:CCGGCCAGAGTGTGAATGTGTTCTTCTCGAGAAGAACACATTCACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-936s1c1
Sequence:CCGGGCCATAGATGAGATGCTGAAACTCGAGTTTCAGCATCTCATCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-902s1c1
Sequence:CCGGGAACCAGAGTGTGAATGTGTTCTCGAGAACACATTCACACTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016546.1-1166s1c1
Sequence:CCGGCTGGCTAACTACTGAGCTGAACTCGAGTTCAGCTCAGTAGTTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181344
C1RL MISSION shRNA Bacterial Glycerol Stock
complement component 1, r subcomponent-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-906s1c1
Sequence:CCGGCCACAACTTCAATGGAGATATCTCGAGATATCTCCATTGAAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-93s1c1
Sequence:CCGGCCCTGGATACCCAGAGCCATACTCGAGTATGGCTCTGGGTATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-487s1c1
Sequence:CCGGCACTGCCAAGATCCTTATTATCTCGAGATAATAAGGATCTTGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-218s1c1
Sequence:CCGGGCGACTCTGTCACAATTTCAACTCGAGTTGAAATTGTGACAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181344
C1RL MISSION shRNA shRNA Plasmid DNA
complement component 1, r subcomponent-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-906s1c1
Sequence:CCGGCCACAACTTCAATGGAGATATCTCGAGATATCTCCATTGAAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-93s1c1
Sequence:CCGGCCCTGGATACCCAGAGCCATACTCGAGTATGGCTCTGGGTATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-487s1c1
Sequence:CCGGCACTGCCAAGATCCTTATTATCTCGAGATAATAAGGATCTTGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-218s1c1
Sequence:CCGGGCGACTCTGTCACAATTTCAACTCGAGTTGAAATTGTGACAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181344
C1RL MISSION shRNA Lentiviral Transduction Particles
complement component 1, r subcomponent-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-906s1c1
Sequence:CCGGCCACAACTTCAATGGAGATATCTCGAGATATCTCCATTGAAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-93s1c1
Sequence:CCGGCCCTGGATACCCAGAGCCATACTCGAGTATGGCTCTGGGTATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-487s1c1
Sequence:CCGGCACTGCCAAGATCCTTATTATCTCGAGATAATAAGGATCTTGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181344.2-218s1c1
Sequence:CCGGGCGACTCTGTCACAATTTCAACTCGAGTTGAAATTGTGACAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks