EMAIL THIS PAGE TO A FRIEND

C1S

complement component 1, s subcomponent

75 Gene Product Result for
Gene ID:
Human(716) Summary: This gene encodes a serine protease, which is a major constituent of the human complement subcomponent C1. C1s associates with two other complement components C1r and C1q in order to yield the first component of the serum complement system. Defects in this gene are the cause of selective C1s deficiency. [provided by RefSeq, Mar 2009]
Mouse(50908) complement component 1, s subcomponent
Rat(192262) complement component 1, s subcomponent
Zebrafish(793529) complement component 1, s subcomponent
cow(767827) complement component 1, s subcomponent
domestic cat(101088676) complement component 1, s subcomponent
dog(486714) complement component 1, s subcomponent
chicken(418294) complement component 1, s subcomponent
sheep(101107688) complement component 1, s subcomponent
domestic guinea pig(100722315) complement component 1, s subcomponent
naked mole-rat(101697979) complement component 1, s subcomponent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1296 Human C1S ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001734 Rosetta Predictions human pricing
NM_201442 Rosetta Predictions human pricing
NM_138900 Rosetta Predictions rat pricing
NM_001097617 Rosetta Predictions mouse pricing
NM_144938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218893 predicted 818
2 SASI_Hs01_00218894 predicted 963
3 SASI_Hs01_00218895 predicted 788
4 SASI_Hs01_00218897 predicted 1388
5 SASI_Hs01_00218898 predicted 1680
6 SASI_Hs01_00218899 predicted 1312
7 SASI_Hs01_00218901 predicted 980
8 SASI_Hs02_00332443 predicted 1020
9 SASI_Hs02_00332444 predicted 414
10 SASI_Hs02_00332445 predicted 422
11 SASI_Hs01_00218892 predicted 549
12 SASI_Hs01_00218896 predicted 1267
13 SASI_Hs01_00218900 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030130 predicted 911
2 SASI_Hs01_00030131 predicted 1053
3 SASI_Hs01_00030132 predicted 883
4 SASI_Hs01_00030134 predicted 1473
5 SASI_Hs01_00030135 predicted 1767
6 SASI_Hs01_00030136 predicted 1408
7 SASI_Hs01_00030138 predicted 1065
8 SASI_Hs02_00372978 predicted 1109
9 SASI_Hs02_00372979 predicted 509
10 SASI_Hs02_00372980 predicted 514
11 SASI_Hs01_00030129 predicted 641
12 SASI_Hs01_00030133 predicted 1355
13 SASI_Hs01_00030137 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268356 predicted 831
2 SASI_Rn02_00268357 predicted 1149
3 SASI_Rn02_00268358 predicted 2235
4 SASI_Rn02_00268359 predicted 2322
5 SASI_Rn02_00268360 predicted 1590
6 SASI_Rn02_00268361 predicted 1005
7 SASI_Rn02_00268362 predicted 2244
8 SASI_Rn02_00268363 predicted 742
9 SASI_Rn01_00104529 predicted 441
10 SASI_Rn02_00268364 predicted 1910
11 SASI_Rn01_00104526 predicted 560
12 SASI_Rn01_00104527 predicted 559
13 SASI_Rn01_00104528 predicted 588
14 SASI_Rn01_00104530 predicted 635
15 SASI_Rn01_00104531 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301169 predicted 1796
2 SASI_Mm02_00301170 predicted 1966
3 SASI_Mm02_00301171 predicted 1746
4 SASI_Mm02_00301172 predicted 1361
5 SASI_Mm02_00301173 predicted 2051
6 SASI_Mm02_00301174 predicted 1682
7 SASI_Mm02_00301175 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038981 predicted 1833
2 SASI_Mm01_00038982 predicted 2002
3 SASI_Mm01_00038983 predicted 1781
4 SASI_Mm01_00038984 predicted 1405
5 SASI_Mm01_00038985 predicted 2085
6 SASI_Mm01_00038986 predicted 1720
7 SASI_Mm01_00038987 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144938
VALIDATED
C1S MISSION shRNA Bacterial Glycerol Stock
complement component 1, s subcomponent
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144938.1-1740s1c1
Sequence:CCGGCTCTACAGTAAACGTGTCTTTCTCGAGAAAGACACGTTTACTGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-1530s1c1
Sequence:CCGGCAAGTGCATCAGAGGATATTTCTCGAGAAATATCCTCTGATGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144938.1-338s1c1
Sequence:CCGGCGTCGTGAAATCTTGGGACATCTCGAGATGTCCCAAGATTTCACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-603s1c1
Sequence:CCGGGCAGCATACTACACTGCCATACTCGAGTATGGCAGTGTAGTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-1581s1c1
Sequence:CCGGCCCTGGCAAGTCTTCTTTAATCTCGAGATTAAAGAAGACTTGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-660s21c1
Sequence:CCGGACACTGCCATAGACATAAATGCTCGAGCATTTATGTCTATGGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1019s21c1
Sequence:CCGGTTTGGTCCTTACTGTGGTAATCTCGAGATTACCACAGTAAGGACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1788s21c1
Sequence:CCGGTCTACAGTAAACGTGTCTTTACTCGAGTAAAGACACGTTTACTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1414s21c1
Sequence:CCGGTGGTACTGTTGTTCACTACACCTCGAGGTGTAGTGAACAACAGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144938.2-2091s21c1
Sequence:CCGGCTGTAAGGCCTGAGGACTATGCTCGAGCATAGTCCTCAGGCCTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144938
VALIDATED
C1S MISSION shRNA shRNA Plasmid DNA
complement component 1, s subcomponent
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144938.1-1740s1c1
Sequence:CCGGCTCTACAGTAAACGTGTCTTTCTCGAGAAAGACACGTTTACTGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-1530s1c1
Sequence:CCGGCAAGTGCATCAGAGGATATTTCTCGAGAAATATCCTCTGATGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144938.1-338s1c1
Sequence:CCGGCGTCGTGAAATCTTGGGACATCTCGAGATGTCCCAAGATTTCACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-603s1c1
Sequence:CCGGGCAGCATACTACACTGCCATACTCGAGTATGGCAGTGTAGTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-1581s1c1
Sequence:CCGGCCCTGGCAAGTCTTCTTTAATCTCGAGATTAAAGAAGACTTGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-660s21c1
Sequence:CCGGACACTGCCATAGACATAAATGCTCGAGCATTTATGTCTATGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1019s21c1
Sequence:CCGGTTTGGTCCTTACTGTGGTAATCTCGAGATTACCACAGTAAGGACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1788s21c1
Sequence:CCGGTCTACAGTAAACGTGTCTTTACTCGAGTAAAGACACGTTTACTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1414s21c1
Sequence:CCGGTGGTACTGTTGTTCACTACACCTCGAGGTGTAGTGAACAACAGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144938.2-2091s21c1
Sequence:CCGGCTGTAAGGCCTGAGGACTATGCTCGAGCATAGTCCTCAGGCCTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144938
VALIDATED
C1S MISSION shRNA Lentiviral Transduction Particles
complement component 1, s subcomponent
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144938.1-1740s1c1
Sequence:CCGGCTCTACAGTAAACGTGTCTTTCTCGAGAAAGACACGTTTACTGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-1530s1c1
Sequence:CCGGCAAGTGCATCAGAGGATATTTCTCGAGAAATATCCTCTGATGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144938.1-338s1c1
Sequence:CCGGCGTCGTGAAATCTTGGGACATCTCGAGATGTCCCAAGATTTCACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-603s1c1
Sequence:CCGGGCAGCATACTACACTGCCATACTCGAGTATGGCAGTGTAGTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144938.1-1581s1c1
Sequence:CCGGCCCTGGCAAGTCTTCTTTAATCTCGAGATTAAAGAAGACTTGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-660s21c1
Sequence:CCGGACACTGCCATAGACATAAATGCTCGAGCATTTATGTCTATGGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1019s21c1
Sequence:CCGGTTTGGTCCTTACTGTGGTAATCTCGAGATTACCACAGTAAGGACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1788s21c1
Sequence:CCGGTCTACAGTAAACGTGTCTTTACTCGAGTAAAGACACGTTTACTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144938.2-1414s21c1
Sequence:CCGGTGGTACTGTTGTTCACTACACCTCGAGGTGTAGTGAACAACAGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144938.2-2091s21c1
Sequence:CCGGCTGTAAGGCCTGAGGACTATGCTCGAGCATAGTCCTCAGGCCTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001734
C1S MISSION shRNA Bacterial Glycerol Stock
complement component 1, s subcomponent
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-703s1c1
Sequence:CCGGCATGAAGAATTGCGGAGTTAACTCGAGTTAACTCCGCAATTCTTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-764s1c1
Sequence:CCGGGCAAGTCCCAATTATCCCAAACTCGAGTTTGGGATAATTGGGACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-1861s1c1
Sequence:CCGGCTCTTCCGACTACAACCTCATCTCGAGATGAGGTTGTAGTCGGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-584s1c1
Sequence:CCGGGTTGCCACAGACATAAATGAACTCGAGTTCATTTATGTCTGTGGCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-1759s1c1
Sequence:CCGGCCCAGAAGGACGAACCAATTTCTCGAGAAATTGGTTCGTCCTTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-998s21c1
Sequence:CCGGTTGCAGGAGATCGGCAATTTGCTCGAGCAAATTGCCGATCTCCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-1428s21c1
Sequence:CCGGCACTTGTGAGGAGCCATATTACTCGAGTAATATGGCTCCTCACAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-704s21c1
Sequence:CCGGGTAGCCACTTCTGCAACAATTCTCGAGAATTGTTGCAGAAGTGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001734
C1S MISSION shRNA shRNA Plasmid DNA
complement component 1, s subcomponent
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-703s1c1
Sequence:CCGGCATGAAGAATTGCGGAGTTAACTCGAGTTAACTCCGCAATTCTTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-764s1c1
Sequence:CCGGGCAAGTCCCAATTATCCCAAACTCGAGTTTGGGATAATTGGGACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-1861s1c1
Sequence:CCGGCTCTTCCGACTACAACCTCATCTCGAGATGAGGTTGTAGTCGGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-584s1c1
Sequence:CCGGGTTGCCACAGACATAAATGAACTCGAGTTCATTTATGTCTGTGGCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-1759s1c1
Sequence:CCGGCCCAGAAGGACGAACCAATTTCTCGAGAAATTGGTTCGTCCTTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-998s21c1
Sequence:CCGGTTGCAGGAGATCGGCAATTTGCTCGAGCAAATTGCCGATCTCCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-1428s21c1
Sequence:CCGGCACTTGTGAGGAGCCATATTACTCGAGTAATATGGCTCCTCACAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-704s21c1
Sequence:CCGGGTAGCCACTTCTGCAACAATTCTCGAGAATTGTTGCAGAAGTGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001734
C1S MISSION shRNA Lentiviral Transduction Particles
complement component 1, s subcomponent
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-703s1c1
Sequence:CCGGCATGAAGAATTGCGGAGTTAACTCGAGTTAACTCCGCAATTCTTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-764s1c1
Sequence:CCGGGCAAGTCCCAATTATCCCAAACTCGAGTTTGGGATAATTGGGACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-1861s1c1
Sequence:CCGGCTCTTCCGACTACAACCTCATCTCGAGATGAGGTTGTAGTCGGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-584s1c1
Sequence:CCGGGTTGCCACAGACATAAATGAACTCGAGTTCATTTATGTCTGTGGCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001734.x-1759s1c1
Sequence:CCGGCCCAGAAGGACGAACCAATTTCTCGAGAAATTGGTTCGTCCTTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-998s21c1
Sequence:CCGGTTGCAGGAGATCGGCAATTTGCTCGAGCAAATTGCCGATCTCCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-1428s21c1
Sequence:CCGGCACTTGTGAGGAGCCATATTACTCGAGTAATATGGCTCCTCACAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001734.3-704s21c1
Sequence:CCGGGTAGCCACTTCTGCAACAATTCTCGAGAATTGTTGCAGAAGTGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)