EMAIL THIS PAGE TO A FRIEND

C1orf100

chromosome 1 open reading frame 100

UniProtKB ID: Q5SVJ3, Q5SVJ4
Gene ID:
chicken(421496) chromosome 3 open reading frame, human C1orf100
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012970 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122171 MISSION® esiRNA esiRNA human C1orf100 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012970 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161939 predicted 328
2 SASI_Hs01_00161940 predicted 341
3 SASI_Hs01_00161941 predicted 299
4 SASI_Hs02_00306270 predicted 309
5 SASI_Hs01_00161942 predicted 262
6 SASI_Hs01_00161943 predicted 319
7 SASI_Hs01_00161944 predicted 326
8 SASI_Hs01_00161946 predicted 258
9 SASI_Hs01_00161947 predicted 256
10 SASI_Hs01_00161948 predicted 262
11 SASI_Hs01_00161945 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012970
C1orf100 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 100
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-381s1c1
Sequence:CCGGCCATGGTATAAAGAAACCACTCTCGAGAGTGGTTTCTTTATACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-265s1c1
Sequence:CCGGGACCGCTCATAGACTTGACAACTCGAGTTGTCAAGTCTATGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-190s1c1
Sequence:CCGGGAAGAGACGTTCAAGGCTATTCTCGAGAATAGCCTTGAACGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-382s1c1
Sequence:CCGGCATGGTATAAAGAAACCACTTCTCGAGAAGTGGTTTCTTTATACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-324s1c1
Sequence:CCGGGACCAACAAACACTCATTCGACTCGAGTCGAATGAGTGTTTGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012970
C1orf100 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 100
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-381s1c1
Sequence:CCGGCCATGGTATAAAGAAACCACTCTCGAGAGTGGTTTCTTTATACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-265s1c1
Sequence:CCGGGACCGCTCATAGACTTGACAACTCGAGTTGTCAAGTCTATGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-190s1c1
Sequence:CCGGGAAGAGACGTTCAAGGCTATTCTCGAGAATAGCCTTGAACGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-382s1c1
Sequence:CCGGCATGGTATAAAGAAACCACTTCTCGAGAAGTGGTTTCTTTATACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-324s1c1
Sequence:CCGGGACCAACAAACACTCATTCGACTCGAGTCGAATGAGTGTTTGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012970
C1orf100 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 100
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-381s1c1
Sequence:CCGGCCATGGTATAAAGAAACCACTCTCGAGAGTGGTTTCTTTATACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-265s1c1
Sequence:CCGGGACCGCTCATAGACTTGACAACTCGAGTTGTCAAGTCTATGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-190s1c1
Sequence:CCGGGAAGAGACGTTCAAGGCTATTCTCGAGAATAGCCTTGAACGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-382s1c1
Sequence:CCGGCATGGTATAAAGAAACCACTTCTCGAGAAGTGGTTTCTTTATACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012970.1-324s1c1
Sequence:CCGGGACCAACAAACACTCATTCGACTCGAGTCGAATGAGTGTTTGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks