EMAIL THIS PAGE TO A FRIEND

C1orf101

chromosome 1 open reading frame 101

59 Gene Product Result for
Synonyms: RP11-523K4.1
Species: Human C1orf101(257044)
UniProtKB ID: Q5SY80, B4DZR4, B7Z7X5, E9PEA3, Q8IYZ6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173807 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031491 MISSION® esiRNA esiRNA human C1orf101 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173807 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012331 predicted 1363
2 SASI_Hs01_00012332 predicted 1418
3 SASI_Hs01_00012333 predicted 2013
4 SASI_Hs01_00012334 predicted 1147
5 SASI_Hs01_00012335 predicted 1675
6 SASI_Hs01_00012336 predicted 349
7 SASI_Hs02_00368664 predicted 1704
8 SASI_Hs01_00012338 predicted 576
9 SASI_Hs01_00012339 predicted 1645
10 SASI_Hs02_00368665 predicted 512
11 SASI_Hs01_00012337 predicted 1217
12 SASI_Hs01_00012340 predicted 2349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173807
C1orf101 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 101
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173807.2-1421s1c1
Sequence:CCGGGCTATGGAACAAGCATAGTATCTCGAGATACTATGCTTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-820s1c1
Sequence:CCGGCCTTTCACACAACTGATTCATCTCGAGATGAATCAGTTGTGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173807.2-2673s1c1
Sequence:CCGGCATGAGGATTTATAGACGATACTCGAGTATCGTCTATAAATCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173807.2-2455s1c1
Sequence:CCGGGTTTACATGAAGCACAGACATCTCGAGATGTCTGTGCTTCATGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-1897s1c1
Sequence:CCGGGTCTGTATGTTATTGTGGAATCTCGAGATTCCACAATAACATACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173807.2-2775s1c1
Sequence:CCGGGCATATAGAGAAACAGTGTATCTCGAGATACACTGTTTCTCTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-238s1c1
Sequence:CCGGCCACGACAGAATTGCGTTGTTCTCGAGAACAACGCAATTCTGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173807
C1orf101 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 101
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173807.2-1421s1c1
Sequence:CCGGGCTATGGAACAAGCATAGTATCTCGAGATACTATGCTTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-820s1c1
Sequence:CCGGCCTTTCACACAACTGATTCATCTCGAGATGAATCAGTTGTGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173807.2-2673s1c1
Sequence:CCGGCATGAGGATTTATAGACGATACTCGAGTATCGTCTATAAATCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173807.2-2455s1c1
Sequence:CCGGGTTTACATGAAGCACAGACATCTCGAGATGTCTGTGCTTCATGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-1897s1c1
Sequence:CCGGGTCTGTATGTTATTGTGGAATCTCGAGATTCCACAATAACATACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173807.2-2775s1c1
Sequence:CCGGGCATATAGAGAAACAGTGTATCTCGAGATACACTGTTTCTCTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-238s1c1
Sequence:CCGGCCACGACAGAATTGCGTTGTTCTCGAGAACAACGCAATTCTGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173807
C1orf101 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 101
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173807.2-1421s1c1
Sequence:CCGGGCTATGGAACAAGCATAGTATCTCGAGATACTATGCTTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-820s1c1
Sequence:CCGGCCTTTCACACAACTGATTCATCTCGAGATGAATCAGTTGTGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173807.2-2673s1c1
Sequence:CCGGCATGAGGATTTATAGACGATACTCGAGTATCGTCTATAAATCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173807.2-2455s1c1
Sequence:CCGGGTTTACATGAAGCACAGACATCTCGAGATGTCTGTGCTTCATGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-1897s1c1
Sequence:CCGGGTCTGTATGTTATTGTGGAATCTCGAGATTCCACAATAACATACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173807.2-2775s1c1
Sequence:CCGGGCATATAGAGAAACAGTGTATCTCGAGATACACTGTTTCTCTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173807.2-238s1c1
Sequence:CCGGCCACGACAGAATTGCGTTGTTCTCGAGAACAACGCAATTCTGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks