EMAIL THIS PAGE TO A FRIEND

C1orf105

chromosome 1 open reading frame 105

39 Gene Product Result for
Species: Human C1orf105(92346)
UniProtKB ID: O95561, Q8IY02
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA028480 Anti-C1orf105 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139240 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154891 MISSION® esiRNA esiRNA human C1orf105 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139240 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015169 predicted 257
2 SASI_Hs01_00015170 predicted 511
3 SASI_Hs01_00015171 predicted 632
4 SASI_Hs01_00015172 predicted 255
5 SASI_Hs01_00015173 predicted 203
6 SASI_Hs01_00015174 predicted 273
7 SASI_Hs01_00015175 predicted 716
8 SASI_Hs01_00015176 predicted 432
9 SASI_Hs01_00015177 predicted 737
10 SASI_Hs01_00015178 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139240
C1orf105 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 105
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-584s1c1
Sequence:CCGGCATGATGACATCCCAACAGAACTCGAGTTCTGTTGGGATGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-711s1c1
Sequence:CCGGCCAGAAAGGAACCAATAGGCACTCGAGTGCCTATTGGTTCCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-297s1c1
Sequence:CCGGCCAGAAGATATCCTCATACCTCTCGAGAGGTATGAGGATATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-583s1c1
Sequence:CCGGCCATGATGACATCCCAACAGACTCGAGTCTGTTGGGATGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-554s1c1
Sequence:CCGGCCCAAATTCCAGACTACACCTCTCGAGAGGTGTAGTCTGGAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139240.2-870s1c1
Sequence:CCGGGCCTTCCTAAGATTGCTGGTACTCGAGTACCAGCAATCTTAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-579s1c1
Sequence:CCGGCTTTCCATGATGACATCCCAACTCGAGTTGGGATGTCATCATGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-541s1c1
Sequence:CCGGGAGTCTTCATCAACCCAAATTCTCGAGAATTTGGGTTGATGAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139240.3-794s21c1
Sequence:CCGGACCTCGCCAAGCCAATCTTTGCTCGAGCAAAGATTGGCTTGGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139240.3-894s21c1
Sequence:CCGGTCTAGCTCTTACCTCTATGTTCTCGAGAACATAGAGGTAAGAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139240.3-511s21c1
Sequence:CCGGGCATCCTTTGAGAATTGTATGCTCGAGCATACAATTCTCAAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139240
C1orf105 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 105
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-584s1c1
Sequence:CCGGCATGATGACATCCCAACAGAACTCGAGTTCTGTTGGGATGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-711s1c1
Sequence:CCGGCCAGAAAGGAACCAATAGGCACTCGAGTGCCTATTGGTTCCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-297s1c1
Sequence:CCGGCCAGAAGATATCCTCATACCTCTCGAGAGGTATGAGGATATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-583s1c1
Sequence:CCGGCCATGATGACATCCCAACAGACTCGAGTCTGTTGGGATGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-554s1c1
Sequence:CCGGCCCAAATTCCAGACTACACCTCTCGAGAGGTGTAGTCTGGAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139240.2-870s1c1
Sequence:CCGGGCCTTCCTAAGATTGCTGGTACTCGAGTACCAGCAATCTTAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-579s1c1
Sequence:CCGGCTTTCCATGATGACATCCCAACTCGAGTTGGGATGTCATCATGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-541s1c1
Sequence:CCGGGAGTCTTCATCAACCCAAATTCTCGAGAATTTGGGTTGATGAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139240.3-794s21c1
Sequence:CCGGACCTCGCCAAGCCAATCTTTGCTCGAGCAAAGATTGGCTTGGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139240.3-894s21c1
Sequence:CCGGTCTAGCTCTTACCTCTATGTTCTCGAGAACATAGAGGTAAGAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139240.3-511s21c1
Sequence:CCGGGCATCCTTTGAGAATTGTATGCTCGAGCATACAATTCTCAAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139240
C1orf105 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 105
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-584s1c1
Sequence:CCGGCATGATGACATCCCAACAGAACTCGAGTTCTGTTGGGATGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-711s1c1
Sequence:CCGGCCAGAAAGGAACCAATAGGCACTCGAGTGCCTATTGGTTCCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-297s1c1
Sequence:CCGGCCAGAAGATATCCTCATACCTCTCGAGAGGTATGAGGATATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-583s1c1
Sequence:CCGGCCATGATGACATCCCAACAGACTCGAGTCTGTTGGGATGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-554s1c1
Sequence:CCGGCCCAAATTCCAGACTACACCTCTCGAGAGGTGTAGTCTGGAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139240.2-870s1c1
Sequence:CCGGGCCTTCCTAAGATTGCTGGTACTCGAGTACCAGCAATCTTAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139240.2-579s1c1
Sequence:CCGGCTTTCCATGATGACATCCCAACTCGAGTTGGGATGTCATCATGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139240.2-541s1c1
Sequence:CCGGGAGTCTTCATCAACCCAAATTCTCGAGAATTTGGGTTGATGAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139240.3-794s21c1
Sequence:CCGGACCTCGCCAAGCCAATCTTTGCTCGAGCAAAGATTGGCTTGGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139240.3-894s21c1
Sequence:CCGGTCTAGCTCTTACCTCTATGTTCTCGAGAACATAGAGGTAAGAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139240.3-511s21c1
Sequence:CCGGGCATCCTTTGAGAATTGTATGCTCGAGCATACAATTCTCAAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks