EMAIL THIS PAGE TO A FRIEND

C1orf106

chromosome 1 open reading frame 106

57 Gene Product Result for
UniProtKB ID: Q3KP66, B4E1K9, E9PFY0, Q9NV65, Q9NVI0
Gene ID:
chicken(430729) chromosome unknown open reading frame, human C1orf106
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018265 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150191 MISSION® esiRNA esiRNA human C1orf106 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018265 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069582 predicted 1287
2 SASI_Hs02_00351633 predicted 1366
3 SASI_Hs01_00069583 predicted 1201
4 SASI_Hs01_00069584 predicted 259
5 SASI_Hs01_00069585 predicted 499
6 SASI_Hs01_00069586 predicted 408
7 SASI_Hs01_00069588 predicted 528
8 SASI_Hs01_00069589 predicted 1819
9 SASI_Hs01_00069590 predicted 1495
10 SASI_Hs01_00069591 predicted 1447
11 SASI_Hs01_00069587 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018265
C1orf106 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 106
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-199s21c1
Sequence:CCGGAGCTCCAGGCTACCTACACAACTCGAGTTGTGTAGGTAGCCTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-1937s21c1
Sequence:CCGGCAGTTTGTGTGCTGCGGAGATCTCGAGATCTCCGCAGCACACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-535s21c1
Sequence:CCGGAGGATCGGAGCGGCTTACAAACTCGAGTTTGTAAGCCGCTCCGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018265.1-1907s1c1
Sequence:CCGGCAGTTTGTGTGCTGTGGAGATCTCGAGATCTCCACAGCACACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018265.1-3067s1c1
Sequence:CCGGGCCTTTCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018265.1-3236s1c1
Sequence:CCGGGCTATGCTTCTGCTCTGAGAACTCGAGTTCTCAGAGCAGAAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018265.1-1942s1c1
Sequence:CCGGCCTGTGCAAGTCTTTGTACCTCTCGAGAGGTACAAAGACTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018265
C1orf106 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 106
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-199s21c1
Sequence:CCGGAGCTCCAGGCTACCTACACAACTCGAGTTGTGTAGGTAGCCTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-1937s21c1
Sequence:CCGGCAGTTTGTGTGCTGCGGAGATCTCGAGATCTCCGCAGCACACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-535s21c1
Sequence:CCGGAGGATCGGAGCGGCTTACAAACTCGAGTTTGTAAGCCGCTCCGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018265.1-1907s1c1
Sequence:CCGGCAGTTTGTGTGCTGTGGAGATCTCGAGATCTCCACAGCACACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018265.1-3067s1c1
Sequence:CCGGGCCTTTCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018265.1-3236s1c1
Sequence:CCGGGCTATGCTTCTGCTCTGAGAACTCGAGTTCTCAGAGCAGAAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018265.1-1942s1c1
Sequence:CCGGCCTGTGCAAGTCTTTGTACCTCTCGAGAGGTACAAAGACTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018265
C1orf106 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 106
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-199s21c1
Sequence:CCGGAGCTCCAGGCTACCTACACAACTCGAGTTGTGTAGGTAGCCTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-1937s21c1
Sequence:CCGGCAGTTTGTGTGCTGCGGAGATCTCGAGATCTCCGCAGCACACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018265.2-535s21c1
Sequence:CCGGAGGATCGGAGCGGCTTACAAACTCGAGTTTGTAAGCCGCTCCGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018265.1-1907s1c1
Sequence:CCGGCAGTTTGTGTGCTGTGGAGATCTCGAGATCTCCACAGCACACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018265.1-3067s1c1
Sequence:CCGGGCCTTTCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140233    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018265.1-3236s1c1
Sequence:CCGGGCTATGCTTCTGCTCTGAGAACTCGAGTTCTCAGAGCAGAAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018265.1-1942s1c1
Sequence:CCGGCCTGTGCAAGTCTTTGTACCTCTCGAGAGGTACAAAGACTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks