EMAIL THIS PAGE TO A FRIEND

C1orf109

chromosome 1 open reading frame 109

75 Gene Product Result for
UniProtKB ID: Q9NX04, D3DPT1, Q8WVD1
Gene ID:
Zebrafish(286778) c1orf109 homolog (H. sapiens)
chicken(419612) chromosome 23 open reading frame, human C1orf109
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017850 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063631 MISSION® esiRNA esiRNA human C1orf109 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017850 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174582 predicted 848
2 SASI_Hs01_00174583 predicted 612
3 SASI_Hs01_00174585 predicted 588
4 SASI_Hs01_00174586 predicted 762
5 SASI_Hs01_00174587 predicted 830
6 SASI_Hs01_00174588 predicted 602
7 SASI_Hs02_00350746 predicted 533
8 SASI_Hs01_00174589 predicted 498
9 SASI_Hs01_00174590 predicted 627
10 SASI_Hs01_00174591 predicted 599
11 SASI_Hs01_00174584 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017850
C1orf109 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 109
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-509s1c1
Sequence:CCGGGAGCGAGTGTTTCAGATCTATCTCGAGATAGATCTGAAACACTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-743s1c1
Sequence:CCGGGAACACCAGGATCTTGTACAACTCGAGTTGTACAAGATCCTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017850.1-1617s1c1
Sequence:CCGGCCGTGTTACTTTCAGATCTTTCTCGAGAAAGATCTGAAAGTAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-769s1c1
Sequence:CCGGCCTATTGAATGTTTCCTTCTTCTCGAGAAGAAGGAAACATTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-617s1c1
Sequence:CCGGCAGGATATTGAGAGACATTATCTCGAGATAATGTCTCTCAATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-643s1c1
Sequence:CCGGGTCGTACCTGAAGAGAAAGTACTCGAGTACTTTCTCTTCAGGTACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017850.1-834s1c1
Sequence:CCGGCCACAGTTGAAGACTGACATTCTCGAGAATGTCAGTCTTCAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-628s1c1
Sequence:CCGGGAGACATTATCGAAAGTCGTACTCGAGTACGACTTTCGATAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-752s1c1
Sequence:CCGGGATCTTGTACAAGATATCCTACTCGAGTAGGATATCTTGTACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-657s1c1
Sequence:CCGGGAAAGTATCTTCTTTCGTCTACTCGAGTAGACGAAAGAAGATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017850
C1orf109 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 109
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-509s1c1
Sequence:CCGGGAGCGAGTGTTTCAGATCTATCTCGAGATAGATCTGAAACACTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-743s1c1
Sequence:CCGGGAACACCAGGATCTTGTACAACTCGAGTTGTACAAGATCCTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017850.1-1617s1c1
Sequence:CCGGCCGTGTTACTTTCAGATCTTTCTCGAGAAAGATCTGAAAGTAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-769s1c1
Sequence:CCGGCCTATTGAATGTTTCCTTCTTCTCGAGAAGAAGGAAACATTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-617s1c1
Sequence:CCGGCAGGATATTGAGAGACATTATCTCGAGATAATGTCTCTCAATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-643s1c1
Sequence:CCGGGTCGTACCTGAAGAGAAAGTACTCGAGTACTTTCTCTTCAGGTACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017850.1-834s1c1
Sequence:CCGGCCACAGTTGAAGACTGACATTCTCGAGAATGTCAGTCTTCAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-628s1c1
Sequence:CCGGGAGACATTATCGAAAGTCGTACTCGAGTACGACTTTCGATAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-752s1c1
Sequence:CCGGGATCTTGTACAAGATATCCTACTCGAGTAGGATATCTTGTACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-657s1c1
Sequence:CCGGGAAAGTATCTTCTTTCGTCTACTCGAGTAGACGAAAGAAGATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017850
C1orf109 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 109
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-509s1c1
Sequence:CCGGGAGCGAGTGTTTCAGATCTATCTCGAGATAGATCTGAAACACTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-743s1c1
Sequence:CCGGGAACACCAGGATCTTGTACAACTCGAGTTGTACAAGATCCTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017850.1-1617s1c1
Sequence:CCGGCCGTGTTACTTTCAGATCTTTCTCGAGAAAGATCTGAAAGTAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-769s1c1
Sequence:CCGGCCTATTGAATGTTTCCTTCTTCTCGAGAAGAAGGAAACATTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-617s1c1
Sequence:CCGGCAGGATATTGAGAGACATTATCTCGAGATAATGTCTCTCAATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-643s1c1
Sequence:CCGGGTCGTACCTGAAGAGAAAGTACTCGAGTACTTTCTCTTCAGGTACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017850.1-834s1c1
Sequence:CCGGCCACAGTTGAAGACTGACATTCTCGAGAATGTCAGTCTTCAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-628s1c1
Sequence:CCGGGAGACATTATCGAAAGTCGTACTCGAGTACGACTTTCGATAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-752s1c1
Sequence:CCGGGATCTTGTACAAGATATCCTACTCGAGTAGGATATCTTGTACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017850.1-657s1c1
Sequence:CCGGGAAAGTATCTTCTTTCGTCTACTCGAGTAGACGAAAGAAGATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks