EMAIL THIS PAGE TO A FRIEND

C1orf110

chromosome 1 open reading frame 110

43 Gene Product Result for
Species: Human C1orf110(339512)
UniProtKB ID: Q86UF4, Q5JSG1, Q6ZW57
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178550 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058191 MISSION® esiRNA esiRNA human C1orf110 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178550 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130774 predicted 414
2 SASI_Hs02_00369791 predicted 1108
3 SASI_Hs02_00369792 predicted 1081
4 SASI_Hs02_00369793 predicted 976
5 SASI_Hs01_00130779 predicted 650
6 SASI_Hs02_00369794 predicted 873
7 SASI_Hs02_00369795 predicted 1060
8 SASI_Hs02_00369796 predicted 1136
9 SASI_Hs02_00369797 predicted 782
10 SASI_Hs02_00369798 predicted 694
11 SASI_Hs01_00130771 predicted 876
12 SASI_Hs01_00130772 predicted 1164
13 SASI_Hs01_00130773 predicted 1278
14 SASI_Hs01_00130775 predicted 1189
15 SASI_Hs01_00130776 predicted 876
16 SASI_Hs01_00130777 predicted 790
17 SASI_Hs01_00130778 predicted 940
18 SASI_Hs01_00130780 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178550
C1orf110 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 110
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178550.2-581s1c1
Sequence:CCGGCAACCACAAGCCCAAGAGAAACTCGAGTTTCTCTTGGGCTTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-610s1c1
Sequence:CCGGGAATCCATCTAAGGACGTAGACTCGAGTCTACGTCCTTAGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-592s1c1
Sequence:CCGGCCAAGAGAAAGATTCTGTGAACTCGAGTTCACAGAATCTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-368s1c1
Sequence:CCGGGAAGATGTTCTCGTGTTCTCACTCGAGTGAGAACACGAGAACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-671s1c1
Sequence:CCGGGTTTCCACCAACACCATAGAACTCGAGTTCTATGGTGTTGGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-222s1c1
Sequence:CCGGGACTAAAGGTTATTTGCCTCTCTCGAGAGAGGCAAATAACCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178550.4-884s21c1
Sequence:CCGGTTCGAAGGCGAGTTCACAAAGCTCGAGCTTTGTGAACTCGCCTTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178550.4-1221s21c1
Sequence:CCGGTTTCCGGGAATATAATATTTCCTCGAGGAAATATTATATTCCCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178550.4-1072s21c1
Sequence:CCGGTCTTCCTCTCTAACCGTTTAACTCGAGTTAAACGGTTAGAGAGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178550
C1orf110 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 110
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178550.2-581s1c1
Sequence:CCGGCAACCACAAGCCCAAGAGAAACTCGAGTTTCTCTTGGGCTTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-610s1c1
Sequence:CCGGGAATCCATCTAAGGACGTAGACTCGAGTCTACGTCCTTAGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-592s1c1
Sequence:CCGGCCAAGAGAAAGATTCTGTGAACTCGAGTTCACAGAATCTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-368s1c1
Sequence:CCGGGAAGATGTTCTCGTGTTCTCACTCGAGTGAGAACACGAGAACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-671s1c1
Sequence:CCGGGTTTCCACCAACACCATAGAACTCGAGTTCTATGGTGTTGGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-222s1c1
Sequence:CCGGGACTAAAGGTTATTTGCCTCTCTCGAGAGAGGCAAATAACCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178550.4-884s21c1
Sequence:CCGGTTCGAAGGCGAGTTCACAAAGCTCGAGCTTTGTGAACTCGCCTTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178550.4-1221s21c1
Sequence:CCGGTTTCCGGGAATATAATATTTCCTCGAGGAAATATTATATTCCCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178550.4-1072s21c1
Sequence:CCGGTCTTCCTCTCTAACCGTTTAACTCGAGTTAAACGGTTAGAGAGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178550
C1orf110 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 110
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178550.2-581s1c1
Sequence:CCGGCAACCACAAGCCCAAGAGAAACTCGAGTTTCTCTTGGGCTTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-610s1c1
Sequence:CCGGGAATCCATCTAAGGACGTAGACTCGAGTCTACGTCCTTAGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-592s1c1
Sequence:CCGGCCAAGAGAAAGATTCTGTGAACTCGAGTTCACAGAATCTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-368s1c1
Sequence:CCGGGAAGATGTTCTCGTGTTCTCACTCGAGTGAGAACACGAGAACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-671s1c1
Sequence:CCGGGTTTCCACCAACACCATAGAACTCGAGTTCTATGGTGTTGGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178550.2-222s1c1
Sequence:CCGGGACTAAAGGTTATTTGCCTCTCTCGAGAGAGGCAAATAACCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178550.4-884s21c1
Sequence:CCGGTTCGAAGGCGAGTTCACAAAGCTCGAGCTTTGTGAACTCGCCTTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178550.4-1221s21c1
Sequence:CCGGTTTCCGGGAATATAATATTTCCTCGAGGAAATATTATATTCCCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178550.4-1072s21c1
Sequence:CCGGTCTTCCTCTCTAACCGTTTAACTCGAGTTAAACGGTTAGAGAGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks