EMAIL THIS PAGE TO A FRIEND

C1orf111

chromosome 1 open reading frame 111

20 Gene Product Result for
Synonyms: RP11-565P22.3
Species: Human C1orf111(284680)
UniProtKB ID: Q5T0L3, Q6X961, Q8NEC3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182581 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143041 MISSION® esiRNA esiRNA human C1orf111 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182581 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020291 predicted 467
2 SASI_Hs01_00020292 predicted 443
3 SASI_Hs01_00020293 predicted 365
4 SASI_Hs01_00020294 predicted 519
5 SASI_Hs01_00020295 predicted 367
6 SASI_Hs01_00020296 predicted 595
7 SASI_Hs01_00020297 predicted 400
8 SASI_Hs01_00020298 predicted 568
9 SASI_Hs01_00020299 predicted 338
10 SASI_Hs02_00370723 predicted 610
11 SASI_Hs01_00020300 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182581
C1orf111 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 111
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182581.3-319s21c1
Sequence:CCGGGAGGCGGAACTGCACTATCTACTCGAGTAGATAGTGCAGTTCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182581.3-366s21c1
Sequence:CCGGACTTCGTGTGTGCAGACAAAGCTCGAGCTTTGTCTGCACACACGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182581.3-933s21c1
Sequence:CCGGCTCTCATCACCTTTGGCTAATCTCGAGATTAGCCAAAGGTGATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-604s1c1
Sequence:CCGGCACAGCAGAATGGCTACAAGTCTCGAGACTTGTAGCCATTCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-257s1c1
Sequence:CCGGGCAAGGGATACAGAACACAGTCTCGAGACTGTGTTCTGTATCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-233s1c1
Sequence:CCGGCCAGTACCAAAGCATCATTGTCTCGAGACAATGATGCTTTGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-240s1c1
Sequence:CCGGCAAAGCATCATTGTCAGGCAACTCGAGTTGCCTGACAATGATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-452s1c1
Sequence:CCGGCAACTGCCTTTCTGAGGACATCTCGAGATGTCCTCAGAAAGGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-475s1c1
Sequence:CCGGCTGAGAACATCTGTTCGTCCTCTCGAGAGGACGAACAGATGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-174s1c1
Sequence:CCGGGACATTGCAAAGACAGCAGTACTCGAGTACTGCTGTCTTTGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182581
C1orf111 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 111
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182581.3-319s21c1
Sequence:CCGGGAGGCGGAACTGCACTATCTACTCGAGTAGATAGTGCAGTTCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182581.3-366s21c1
Sequence:CCGGACTTCGTGTGTGCAGACAAAGCTCGAGCTTTGTCTGCACACACGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182581.3-933s21c1
Sequence:CCGGCTCTCATCACCTTTGGCTAATCTCGAGATTAGCCAAAGGTGATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-604s1c1
Sequence:CCGGCACAGCAGAATGGCTACAAGTCTCGAGACTTGTAGCCATTCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-257s1c1
Sequence:CCGGGCAAGGGATACAGAACACAGTCTCGAGACTGTGTTCTGTATCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-233s1c1
Sequence:CCGGCCAGTACCAAAGCATCATTGTCTCGAGACAATGATGCTTTGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-240s1c1
Sequence:CCGGCAAAGCATCATTGTCAGGCAACTCGAGTTGCCTGACAATGATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-452s1c1
Sequence:CCGGCAACTGCCTTTCTGAGGACATCTCGAGATGTCCTCAGAAAGGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-475s1c1
Sequence:CCGGCTGAGAACATCTGTTCGTCCTCTCGAGAGGACGAACAGATGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-174s1c1
Sequence:CCGGGACATTGCAAAGACAGCAGTACTCGAGTACTGCTGTCTTTGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182581
C1orf111 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 111
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182581.3-319s21c1
Sequence:CCGGGAGGCGGAACTGCACTATCTACTCGAGTAGATAGTGCAGTTCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182581.3-366s21c1
Sequence:CCGGACTTCGTGTGTGCAGACAAAGCTCGAGCTTTGTCTGCACACACGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182581.3-933s21c1
Sequence:CCGGCTCTCATCACCTTTGGCTAATCTCGAGATTAGCCAAAGGTGATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-604s1c1
Sequence:CCGGCACAGCAGAATGGCTACAAGTCTCGAGACTTGTAGCCATTCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-257s1c1
Sequence:CCGGGCAAGGGATACAGAACACAGTCTCGAGACTGTGTTCTGTATCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-233s1c1
Sequence:CCGGCCAGTACCAAAGCATCATTGTCTCGAGACAATGATGCTTTGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-240s1c1
Sequence:CCGGCAAAGCATCATTGTCAGGCAACTCGAGTTGCCTGACAATGATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-452s1c1
Sequence:CCGGCAACTGCCTTTCTGAGGACATCTCGAGATGTCCTCAGAAAGGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-475s1c1
Sequence:CCGGCTGAGAACATCTGTTCGTCCTCTCGAGAGGACGAACAGATGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182581.1-174s1c1
Sequence:CCGGGACATTGCAAAGACAGCAGTACTCGAGTACTGCTGTCTTTGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks