EMAIL THIS PAGE TO A FRIEND

C1orf112

chromosome 1 open reading frame 112

Synonyms: RP1-97P20.1
Species: Human C1orf112(55732)
UniProtKB ID: Q9NSG2, A6NFP1, B3KU42, Q3KNQ1, Q9H8L5, Q9NVJ0
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018186 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058841 MISSION® esiRNA esiRNA human C1orf112 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018186 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351452 predicted 2550
2 SASI_Hs02_00351453 predicted 2677
3 SASI_Hs01_00095774 predicted 2039
4 SASI_Hs02_00351454 predicted 1034
5 SASI_Hs01_00095776 predicted 1934
6 SASI_Hs01_00095777 predicted 1270
7 SASI_Hs01_00095778 predicted 2837
8 SASI_Hs02_00351455 predicted 1560
9 SASI_Hs01_00095779 predicted 880
10 SASI_Hs01_00095781 predicted 1207
11 SASI_Hs01_00095775 predicted 1544
12 SASI_Hs01_00095780 predicted 1391
13 SASI_Hs01_00095782 predicted 835
14 SASI_Hs01_00095783 predicted 2128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018186
VALIDATED
C1orf112 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 112
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1548s1c1
Sequence:CCGGGCAAGTTTCCTCCAAGCCTTTCTCGAGAAAGGCTTGGAGGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1477s1c1
Sequence:CCGGCGCTAAGGAATTTCTTCCTTTCTCGAGAAAGGAAGAAATTCCTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018186.2-2239s1c1
Sequence:CCGGGCTGGAGTTTATCCAGAAATTCTCGAGAATTTCTGGATAAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018186.2-1133s1c1
Sequence:CCGGGACCCTTTAGTAGATGACAATCTCGAGATTGTCATCTACTAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1648s1c1
Sequence:CCGGGCTGCTCACATTTCAGCCTTTCTCGAGAAAGGCTGAAATGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1937s1c1
Sequence:CCGGGTCACCTTGTATCAGCATGTTCTCGAGAACATGCTGATACAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-2680s1c1
Sequence:CCGGGCTTCCTGACTATGTTCGTTTCTCGAGAAACGAACATAGTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018186.2-2031s21c1
Sequence:CCGGATGCTGTACTTAGTGCTAATACTCGAGTATTAGCACTAAGTACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018186.2-846s21c1
Sequence:CCGGAGACCACTCTAAGGAATATTTCTCGAGAAATATTCCTTAGAGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018186
VALIDATED
C1orf112 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 112
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1548s1c1
Sequence:CCGGGCAAGTTTCCTCCAAGCCTTTCTCGAGAAAGGCTTGGAGGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1477s1c1
Sequence:CCGGCGCTAAGGAATTTCTTCCTTTCTCGAGAAAGGAAGAAATTCCTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018186.2-2239s1c1
Sequence:CCGGGCTGGAGTTTATCCAGAAATTCTCGAGAATTTCTGGATAAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018186.2-1133s1c1
Sequence:CCGGGACCCTTTAGTAGATGACAATCTCGAGATTGTCATCTACTAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1648s1c1
Sequence:CCGGGCTGCTCACATTTCAGCCTTTCTCGAGAAAGGCTGAAATGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1937s1c1
Sequence:CCGGGTCACCTTGTATCAGCATGTTCTCGAGAACATGCTGATACAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-2680s1c1
Sequence:CCGGGCTTCCTGACTATGTTCGTTTCTCGAGAAACGAACATAGTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018186.2-2031s21c1
Sequence:CCGGATGCTGTACTTAGTGCTAATACTCGAGTATTAGCACTAAGTACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018186.2-846s21c1
Sequence:CCGGAGACCACTCTAAGGAATATTTCTCGAGAAATATTCCTTAGAGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018186
VALIDATED
C1orf112 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 112
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1548s1c1
Sequence:CCGGGCAAGTTTCCTCCAAGCCTTTCTCGAGAAAGGCTTGGAGGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1477s1c1
Sequence:CCGGCGCTAAGGAATTTCTTCCTTTCTCGAGAAAGGAAGAAATTCCTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018186.2-2239s1c1
Sequence:CCGGGCTGGAGTTTATCCAGAAATTCTCGAGAATTTCTGGATAAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018186.2-1133s1c1
Sequence:CCGGGACCCTTTAGTAGATGACAATCTCGAGATTGTCATCTACTAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1648s1c1
Sequence:CCGGGCTGCTCACATTTCAGCCTTTCTCGAGAAAGGCTGAAATGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-1937s1c1
Sequence:CCGGGTCACCTTGTATCAGCATGTTCTCGAGAACATGCTGATACAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018186.2-2680s1c1
Sequence:CCGGGCTTCCTGACTATGTTCGTTTCTCGAGAAACGAACATAGTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018186.2-2031s21c1
Sequence:CCGGATGCTGTACTTAGTGCTAATACTCGAGTATTAGCACTAAGTACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018186.2-846s21c1
Sequence:CCGGAGACCACTCTAAGGAATATTTCTCGAGAAATATTCCTTAGAGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks