EMAIL THIS PAGE TO A FRIEND

C1orf115

chromosome 1 open reading frame 115

70 Gene Product Result for
Synonyms: RP11-322F10.4
Species: Human C1orf115(79762)
UniProtKB ID: Q9H7X2, B3KRN3, D3DTB2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302321 ANTI-CA115 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024709 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179540 predicted 919
2 SASI_Hs01_00179541 predicted 914
3 SASI_Hs01_00179542 predicted 1025
4 SASI_Hs01_00179543 predicted 858
5 SASI_Hs01_00179544 predicted 765
6 SASI_Hs01_00179545 predicted 1008
7 SASI_Hs01_00179546 predicted 694
8 SASI_Hs01_00179547 predicted 521
9 SASI_Hs01_00179548 predicted 753
10 SASI_Hs01_00179549 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024709
VALIDATED
C1orf115 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 115
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024709.4-423s21c1
Sequence:CCGGCAAGAATGTCGGGAAGGTCATCTCGAGATGACCTTCCCGACATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024709.4-2266s21c1
Sequence:CCGGGCCCAGATGATGAAAGTGGATCTCGAGATCCACTTTCATCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024709.4-1941s21c1
Sequence:CCGGGCCACTGTTCTGACTTTGTTTCTCGAGAAACAAAGTCAGAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024709.4-409s21c1
Sequence:CCGGCTGAAGAAGTACGGCAAGAATCTCGAGATTCTTGCCGTACTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024709.4-2083s21c1
Sequence:CCGGCCCTACCAAGACAGACAGAAACTCGAGTTTCTGTCTGTCTTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-407s1c1
Sequence:CCGGCATCATCAAAGGATGCCGCTACTCGAGTAGCGGCATCCTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-371s1c1
Sequence:CCGGGAAGCTGAAGAAGTACGGCAACTCGAGTTGCCGTACTTCTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2049s1c1
Sequence:CCGGCCCTACCAAGACAGACAGAAACTCGAGTTTCTGTCTGTCTTGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-389s1c1
Sequence:CCGGCAAGAATGTCGGGAAGGTCATCTCGAGATGACCTTCCCGACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-374s1c1
Sequence:CCGGGCTGAAGAAGTACGGCAAGAACTCGAGTTCTTGCCGTACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-401s1c1
Sequence:CCGGGAAGGTCATCATCAAAGGATGCTCGAGCATCCTTTGATGATGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-1907s1c1
Sequence:CCGGGCCACTGTTCTGACTTTGTTTCTCGAGAAACAAAGTCAGAACAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-377s1c1
Sequence:CCGGGAAGAAGTACGGCAAGAATGTCTCGAGACATTCTTGCCGTACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-375s1c1
Sequence:CCGGCTGAAGAAGTACGGCAAGAATCTCGAGATTCTTGCCGTACTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2818s1c1
Sequence:CCGGGCCCACACCTTACTGAGTATTCTCGAGAATACTCAGTAAGGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2232s1c1
Sequence:CCGGGCCCAGATGATGAAAGTGGATCTCGAGATCCACTTTCATCATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024709
VALIDATED
C1orf115 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 115
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024709.4-423s21c1
Sequence:CCGGCAAGAATGTCGGGAAGGTCATCTCGAGATGACCTTCCCGACATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024709.4-2266s21c1
Sequence:CCGGGCCCAGATGATGAAAGTGGATCTCGAGATCCACTTTCATCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024709.4-1941s21c1
Sequence:CCGGGCCACTGTTCTGACTTTGTTTCTCGAGAAACAAAGTCAGAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024709.4-409s21c1
Sequence:CCGGCTGAAGAAGTACGGCAAGAATCTCGAGATTCTTGCCGTACTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024709.4-2083s21c1
Sequence:CCGGCCCTACCAAGACAGACAGAAACTCGAGTTTCTGTCTGTCTTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-407s1c1
Sequence:CCGGCATCATCAAAGGATGCCGCTACTCGAGTAGCGGCATCCTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-371s1c1
Sequence:CCGGGAAGCTGAAGAAGTACGGCAACTCGAGTTGCCGTACTTCTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2049s1c1
Sequence:CCGGCCCTACCAAGACAGACAGAAACTCGAGTTTCTGTCTGTCTTGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-389s1c1
Sequence:CCGGCAAGAATGTCGGGAAGGTCATCTCGAGATGACCTTCCCGACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-374s1c1
Sequence:CCGGGCTGAAGAAGTACGGCAAGAACTCGAGTTCTTGCCGTACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-401s1c1
Sequence:CCGGGAAGGTCATCATCAAAGGATGCTCGAGCATCCTTTGATGATGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-1907s1c1
Sequence:CCGGGCCACTGTTCTGACTTTGTTTCTCGAGAAACAAAGTCAGAACAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-377s1c1
Sequence:CCGGGAAGAAGTACGGCAAGAATGTCTCGAGACATTCTTGCCGTACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-375s1c1
Sequence:CCGGCTGAAGAAGTACGGCAAGAATCTCGAGATTCTTGCCGTACTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2818s1c1
Sequence:CCGGGCCCACACCTTACTGAGTATTCTCGAGAATACTCAGTAAGGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2232s1c1
Sequence:CCGGGCCCAGATGATGAAAGTGGATCTCGAGATCCACTTTCATCATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024709
VALIDATED
C1orf115 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 115
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024709.4-423s21c1
Sequence:CCGGCAAGAATGTCGGGAAGGTCATCTCGAGATGACCTTCCCGACATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024709.4-2266s21c1
Sequence:CCGGGCCCAGATGATGAAAGTGGATCTCGAGATCCACTTTCATCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024709.4-1941s21c1
Sequence:CCGGGCCACTGTTCTGACTTTGTTTCTCGAGAAACAAAGTCAGAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024709.4-409s21c1
Sequence:CCGGCTGAAGAAGTACGGCAAGAATCTCGAGATTCTTGCCGTACTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024709.4-2083s21c1
Sequence:CCGGCCCTACCAAGACAGACAGAAACTCGAGTTTCTGTCTGTCTTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-407s1c1
Sequence:CCGGCATCATCAAAGGATGCCGCTACTCGAGTAGCGGCATCCTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-371s1c1
Sequence:CCGGGAAGCTGAAGAAGTACGGCAACTCGAGTTGCCGTACTTCTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2049s1c1
Sequence:CCGGCCCTACCAAGACAGACAGAAACTCGAGTTTCTGTCTGTCTTGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-389s1c1
Sequence:CCGGCAAGAATGTCGGGAAGGTCATCTCGAGATGACCTTCCCGACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-374s1c1
Sequence:CCGGGCTGAAGAAGTACGGCAAGAACTCGAGTTCTTGCCGTACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024709.2-401s1c1
Sequence:CCGGGAAGGTCATCATCAAAGGATGCTCGAGCATCCTTTGATGATGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-1907s1c1
Sequence:CCGGGCCACTGTTCTGACTTTGTTTCTCGAGAAACAAAGTCAGAACAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-377s1c1
Sequence:CCGGGAAGAAGTACGGCAAGAATGTCTCGAGACATTCTTGCCGTACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-375s1c1
Sequence:CCGGCTGAAGAAGTACGGCAAGAATCTCGAGATTCTTGCCGTACTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2818s1c1
Sequence:CCGGGCCCACACCTTACTGAGTATTCTCGAGAATACTCAGTAAGGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024709.2-2232s1c1
Sequence:CCGGGCCCAGATGATGAAAGTGGATCTCGAGATCCACTTTCATCATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks