EMAIL THIS PAGE TO A FRIEND

C1orf116

chromosome 1 open reading frame 116

91 Gene Product Result for
Synonyms: SARG
Gene ID:
chicken(419849) chromosome 26 open reading frame, human C1orf116
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024115 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052801 MISSION® esiRNA esiRNA human C1orf116 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083924 Rosetta Predictions human pricing
NM_023938 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317311 predicted 1607
2 SASI_Hs02_00317312 predicted 1733
3 SASI_Hs02_00317313 predicted 1544
4 SASI_Hs02_00317314 predicted 2305
5 SASI_Hs02_00317315 predicted 874
6 SASI_Hs02_00317316 predicted 1532
7 SASI_Hs02_00317317 predicted 1624
8 SASI_Hs02_00317318 predicted 1554
9 SASI_Hs02_00317319 predicted 821
10 SASI_Hs02_00317320 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247006 predicted 1920
2 SASI_Hs02_00356406 predicted 1727
3 SASI_Hs02_00356407 predicted 2486
4 SASI_Hs02_00356408 predicted 1067
5 SASI_Hs01_00247011 predicted 1719
6 SASI_Hs01_00247012 predicted 1816
7 SASI_Hs02_00356409 predicted 1736
8 SASI_Hs02_00356410 predicted 1010
9 SASI_Hs02_00356411 predicted 679
10 SASI_Hs02_00356412 predicted 1163
11 SASI_Hs01_00247007 predicted 478
12 SASI_Hs01_00247008 predicted 284
13 SASI_Hs01_00247009 predicted 372
14 SASI_Hs01_00247010 predicted 967
15 SASI_Hs01_00247013 predicted 492
16 SASI_Hs01_00247014 predicted 366
17 SASI_Hs01_00247015 predicted 1716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024115
C1orf116 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 116
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-182s1c1
Sequence:CCGGAGCACCATCAAAGCCCAGAATCTCGAGATTCTGGGCTTTGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-120s1c1
Sequence:CCGGTGTTGCTGGAAAGGTGCCTTTCTCGAGAAAGGCACCTTTCCAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-165s1c1
Sequence:CCGGTGTGTCCTGATGGACGCAGCACTCGAGTGCTGCGTCCATCAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-172s1c1
Sequence:CCGGTGATGGACGCAGCACCATCAACTCGAGTTGATGGTGCTGCGTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-155s1c1
Sequence:CCGGATTTCTGGACTGTGTCCTGATCTCGAGATCAGGACACAGTCCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024115
C1orf116 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 116
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-182s1c1
Sequence:CCGGAGCACCATCAAAGCCCAGAATCTCGAGATTCTGGGCTTTGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-120s1c1
Sequence:CCGGTGTTGCTGGAAAGGTGCCTTTCTCGAGAAAGGCACCTTTCCAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-165s1c1
Sequence:CCGGTGTGTCCTGATGGACGCAGCACTCGAGTGCTGCGTCCATCAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-172s1c1
Sequence:CCGGTGATGGACGCAGCACCATCAACTCGAGTTGATGGTGCTGCGTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-155s1c1
Sequence:CCGGATTTCTGGACTGTGTCCTGATCTCGAGATCAGGACACAGTCCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024115
C1orf116 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 116
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-182s1c1
Sequence:CCGGAGCACCATCAAAGCCCAGAATCTCGAGATTCTGGGCTTTGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-120s1c1
Sequence:CCGGTGTTGCTGGAAAGGTGCCTTTCTCGAGAAAGGCACCTTTCCAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-165s1c1
Sequence:CCGGTGTGTCCTGATGGACGCAGCACTCGAGTGCTGCGTCCATCAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-172s1c1
Sequence:CCGGTGATGGACGCAGCACCATCAACTCGAGTTGATGGTGCTGCGTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024115.1-155s1c1
Sequence:CCGGATTTCTGGACTGTGTCCTGATCTCGAGATCAGGACACAGTCCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks