EMAIL THIS PAGE TO A FRIEND

C1orf122

chromosome 1 open reading frame 122

84 Gene Product Result for
Synonyms: ALAESM
Species: Human C1orf122(127687)
UniProtKB ID: Q6ZSJ8, A2RQF4, E9PQ13, Q56A71
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105909 Anti-C1ORF122, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198446 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033131 MISSION® esiRNA esiRNA human C1orf122 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198446 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050924 predicted 386
2 SASI_Hs01_00050925 predicted 477
3 SASI_Hs01_00050926 predicted 287
4 SASI_Hs01_00050927 predicted 324
5 SASI_Hs02_00371955 predicted 337
6 SASI_Hs01_00050929 predicted 389
7 SASI_Hs01_00050930 predicted 496
8 SASI_Hs01_00050931 predicted 339
9 SASI_Hs01_00050932 predicted 581
10 SASI_Hs01_00050933 predicted 487
11 SASI_Hs01_00050928 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198446
VALIDATED
C1orf122 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 122
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-486s1c1
Sequence:CCGGCGGTGGCTGGACTCTGAACAACTCGAGTTGTTCAGAGTCCAGCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-655s1c1
Sequence:CCGGCCAGTCTGATTACCCAGATTTCTCGAGAAATCTGGGTAATCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-499s1c1
Sequence:CCGGCTGAACAACTCCCTTCAGTAACTCGAGTTACTGAAGGGAGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198446.1-644s1c1
Sequence:CCGGCCAATGAATACCCAGTCTGATCTCGAGATCAGACTGGGTATTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-495s1c1
Sequence:CCGGGACTCTGAACAACTCCCTTCACTCGAGTGAAGGGAGTTGTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-450s1c1
Sequence:CCGGGAGCAGAATACCCTGACTTCTCTCGAGAGAAGTCAGGGTATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-497s1c1
Sequence:CCGGCTCTGAACAACTCCCTTCAGTCTCGAGACTGAAGGGAGTTGTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198446.1-452s1c1
Sequence:CCGGGCAGAATACCCTGACTTCTCTCTCGAGAGAGAAGTCAGGGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-645s1c1
Sequence:CCGGCAATGAATACCCAGTCTGATTCTCGAGAATCAGACTGGGTATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-631s1c1
Sequence:CCGGCTTTGAAATGCAGCCAATGAACTCGAGTTCATTGGCTGCATTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198446
VALIDATED
C1orf122 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 122
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-486s1c1
Sequence:CCGGCGGTGGCTGGACTCTGAACAACTCGAGTTGTTCAGAGTCCAGCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-655s1c1
Sequence:CCGGCCAGTCTGATTACCCAGATTTCTCGAGAAATCTGGGTAATCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-499s1c1
Sequence:CCGGCTGAACAACTCCCTTCAGTAACTCGAGTTACTGAAGGGAGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198446.1-644s1c1
Sequence:CCGGCCAATGAATACCCAGTCTGATCTCGAGATCAGACTGGGTATTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-495s1c1
Sequence:CCGGGACTCTGAACAACTCCCTTCACTCGAGTGAAGGGAGTTGTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-450s1c1
Sequence:CCGGGAGCAGAATACCCTGACTTCTCTCGAGAGAAGTCAGGGTATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-497s1c1
Sequence:CCGGCTCTGAACAACTCCCTTCAGTCTCGAGACTGAAGGGAGTTGTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198446.1-452s1c1
Sequence:CCGGGCAGAATACCCTGACTTCTCTCTCGAGAGAGAAGTCAGGGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-645s1c1
Sequence:CCGGCAATGAATACCCAGTCTGATTCTCGAGAATCAGACTGGGTATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-631s1c1
Sequence:CCGGCTTTGAAATGCAGCCAATGAACTCGAGTTCATTGGCTGCATTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198446
VALIDATED
C1orf122 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 122
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-486s1c1
Sequence:CCGGCGGTGGCTGGACTCTGAACAACTCGAGTTGTTCAGAGTCCAGCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-655s1c1
Sequence:CCGGCCAGTCTGATTACCCAGATTTCTCGAGAAATCTGGGTAATCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-499s1c1
Sequence:CCGGCTGAACAACTCCCTTCAGTAACTCGAGTTACTGAAGGGAGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198446.1-644s1c1
Sequence:CCGGCCAATGAATACCCAGTCTGATCTCGAGATCAGACTGGGTATTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-495s1c1
Sequence:CCGGGACTCTGAACAACTCCCTTCACTCGAGTGAAGGGAGTTGTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-450s1c1
Sequence:CCGGGAGCAGAATACCCTGACTTCTCTCGAGAGAAGTCAGGGTATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198446.1-497s1c1
Sequence:CCGGCTCTGAACAACTCCCTTCAGTCTCGAGACTGAAGGGAGTTGTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198446.1-452s1c1
Sequence:CCGGGCAGAATACCCTGACTTCTCTCTCGAGAGAGAAGTCAGGGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-645s1c1
Sequence:CCGGCAATGAATACCCAGTCTGATTCTCGAGAATCAGACTGGGTATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198446.1-631s1c1
Sequence:CCGGCTTTGAAATGCAGCCAATGAACTCGAGTTCATTGGCTGCATTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks