EMAIL THIS PAGE TO A FRIEND

C1orf123

chromosome 1 open reading frame 123

30 Gene Product Result for
Species: Human C1orf123(54987)
UniProtKB ID: Q9NWV4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138341 MISSION® esiRNA esiRNA human C1orf123 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017887 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212893 predicted 417
2 SASI_Hs01_00212894 predicted 740
3 SASI_Hs01_00212895 predicted 596
4 SASI_Hs01_00212896 predicted 541
5 SASI_Hs01_00212897 predicted 279
6 SASI_Hs01_00212898 predicted 424
7 SASI_Hs01_00212899 predicted 439
8 SASI_Hs01_00212900 predicted 345
9 SASI_Hs01_00212901 predicted 611
10 SASI_Hs01_00212902 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017887
VALIDATED
C1orf123 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 123
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-444s1c1
Sequence:CCGGGAAGGACTGGACTGACTATGACTCGAGTCATAGTCAGTCCAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017887.1-553s1c1
Sequence:CCGGGAACTGAGAAAGGACAAAGTACTCGAGTACTTTGTCCTTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-288s1c1
Sequence:CCGGCATCAAGCCTTACAATGCTGACTCGAGTCAGCATTGTAAGGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017887.1-832s1c1
Sequence:CCGGCAAGGGCAAGTTTACAGAGATCTCGAGATCTCTGTAAACTTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017887.1-628s1c1
Sequence:CCGGGCTATACGAAACCTTCACAATCTCGAGATTGTGAAGGTTTCGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-156s1c1
Sequence:CCGGGATTTCGGACAAGTGGCAGTACTCGAGTACTGCCACTTGTCCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-156s21c1
Sequence:CCGGGATTTCGGACAAGTGGCAGTACTCGAGTACTGCCACTTGTCCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017887.1-628s21c1
Sequence:CCGGGCTATACGAAACCTTCACAATCTCGAGATTGTGAAGGTTTCGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-444s21c1
Sequence:CCGGGAAGGACTGGACTGACTATGACTCGAGTCATAGTCAGTCCAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017887.1-553s21c1
Sequence:CCGGGAACTGAGAAAGGACAAAGTACTCGAGTACTTTGTCCTTTCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-288s21c1
Sequence:CCGGCATCAAGCCTTACAATGCTGACTCGAGTCAGCATTGTAAGGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017887
VALIDATED
C1orf123 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 123
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-444s1c1
Sequence:CCGGGAAGGACTGGACTGACTATGACTCGAGTCATAGTCAGTCCAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017887.1-553s1c1
Sequence:CCGGGAACTGAGAAAGGACAAAGTACTCGAGTACTTTGTCCTTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-288s1c1
Sequence:CCGGCATCAAGCCTTACAATGCTGACTCGAGTCAGCATTGTAAGGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017887.1-832s1c1
Sequence:CCGGCAAGGGCAAGTTTACAGAGATCTCGAGATCTCTGTAAACTTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017887.1-628s1c1
Sequence:CCGGGCTATACGAAACCTTCACAATCTCGAGATTGTGAAGGTTTCGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-156s1c1
Sequence:CCGGGATTTCGGACAAGTGGCAGTACTCGAGTACTGCCACTTGTCCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-156s21c1
Sequence:CCGGGATTTCGGACAAGTGGCAGTACTCGAGTACTGCCACTTGTCCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017887.1-628s21c1
Sequence:CCGGGCTATACGAAACCTTCACAATCTCGAGATTGTGAAGGTTTCGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-444s21c1
Sequence:CCGGGAAGGACTGGACTGACTATGACTCGAGTCATAGTCAGTCCAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017887.1-553s21c1
Sequence:CCGGGAACTGAGAAAGGACAAAGTACTCGAGTACTTTGTCCTTTCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-288s21c1
Sequence:CCGGCATCAAGCCTTACAATGCTGACTCGAGTCAGCATTGTAAGGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017887
VALIDATED
C1orf123 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 123
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-444s1c1
Sequence:CCGGGAAGGACTGGACTGACTATGACTCGAGTCATAGTCAGTCCAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017887.1-553s1c1
Sequence:CCGGGAACTGAGAAAGGACAAAGTACTCGAGTACTTTGTCCTTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-288s1c1
Sequence:CCGGCATCAAGCCTTACAATGCTGACTCGAGTCAGCATTGTAAGGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017887.1-832s1c1
Sequence:CCGGCAAGGGCAAGTTTACAGAGATCTCGAGATCTCTGTAAACTTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017887.1-628s1c1
Sequence:CCGGGCTATACGAAACCTTCACAATCTCGAGATTGTGAAGGTTTCGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017887.1-156s1c1
Sequence:CCGGGATTTCGGACAAGTGGCAGTACTCGAGTACTGCCACTTGTCCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-156s21c1
Sequence:CCGGGATTTCGGACAAGTGGCAGTACTCGAGTACTGCCACTTGTCCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017887.1-628s21c1
Sequence:CCGGGCTATACGAAACCTTCACAATCTCGAGATTGTGAAGGTTTCGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-444s21c1
Sequence:CCGGGAAGGACTGGACTGACTATGACTCGAGTCATAGTCAGTCCAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017887.1-553s21c1
Sequence:CCGGGAACTGAGAAAGGACAAAGTACTCGAGTACTTTGTCCTTTCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017887.1-288s21c1
Sequence:CCGGCATCAAGCCTTACAATGCTGACTCGAGTCAGCATTGTAAGGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks