EMAIL THIS PAGE TO A FRIEND

C1orf127

chromosome 1 open reading frame 127

19 Gene Product Result for
Species: Human C1orf127(148345)
UniProtKB ID: Q8N9H9, A0AVG8, A6NKM7, Q5VXJ2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301045 ANTI-C1ORF127 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173507 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148981 MISSION® esiRNA esiRNA human C1orf127 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173507 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183756 predicted 828
2 SASI_Hs01_00183757 predicted 1117
3 SASI_Hs01_00183758 predicted 289
4 SASI_Hs01_00183759 predicted 507
5 SASI_Hs02_00368277 predicted 795
6 SASI_Hs02_00368278 predicted 279
7 SASI_Hs01_00183760 predicted 383
8 SASI_Hs01_00183762 predicted 1257
9 SASI_Hs01_00183763 predicted 321
10 SASI_Hs01_00183764 predicted 214
11 SASI_Hs01_00183755 predicted 1603
12 SASI_Hs01_00183761 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173507
C1orf127 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 127
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1077s1c1
Sequence:CCGGCCTGAACGACCTGAATCACTTCTCGAGAAGTGATTCAGGTCGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1599s1c1
Sequence:CCGGCTGGCAGTTCTTCCTATGGAACTCGAGTTCCATAGGAAGAACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-807s1c1
Sequence:CCGGCCATTCCTGCAAACAGCCAAACTCGAGTTTGGCTGTTTGCAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1602s1c1
Sequence:CCGGGCAGTTCTTCCTATGGAACCTCTCGAGAGGTTCCATAGGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1122s1c1
Sequence:CCGGCTGACTGAAGGTCTAGGAACTCTCGAGAGTTCCTAGACCTTCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173507
C1orf127 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 127
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1077s1c1
Sequence:CCGGCCTGAACGACCTGAATCACTTCTCGAGAAGTGATTCAGGTCGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1599s1c1
Sequence:CCGGCTGGCAGTTCTTCCTATGGAACTCGAGTTCCATAGGAAGAACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-807s1c1
Sequence:CCGGCCATTCCTGCAAACAGCCAAACTCGAGTTTGGCTGTTTGCAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1602s1c1
Sequence:CCGGGCAGTTCTTCCTATGGAACCTCTCGAGAGGTTCCATAGGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1122s1c1
Sequence:CCGGCTGACTGAAGGTCTAGGAACTCTCGAGAGTTCCTAGACCTTCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173507
C1orf127 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 127
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1077s1c1
Sequence:CCGGCCTGAACGACCTGAATCACTTCTCGAGAAGTGATTCAGGTCGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1599s1c1
Sequence:CCGGCTGGCAGTTCTTCCTATGGAACTCGAGTTCCATAGGAAGAACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-807s1c1
Sequence:CCGGCCATTCCTGCAAACAGCCAAACTCGAGTTTGGCTGTTTGCAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1602s1c1
Sequence:CCGGGCAGTTCTTCCTATGGAACCTCTCGAGAGGTTCCATAGGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173507.1-1122s1c1
Sequence:CCGGCTGACTGAAGGTCTAGGAACTCTCGAGAGTTCCTAGACCTTCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks