EMAIL THIS PAGE TO A FRIEND

C1orf131

chromosome 1 open reading frame 131

62 Gene Product Result for
Gene ID:
chicken(421547) chromosome 3 open reading frame, human C1orf131
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152379 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023450 predicted 818
2 SASI_Hs02_00366032 predicted 1178
3 SASI_Hs01_00023451 predicted 523
4 SASI_Hs01_00023452 predicted 478
5 SASI_Hs01_00023453 predicted 559
6 SASI_Hs01_00023454 predicted 938
7 SASI_Hs01_00023456 predicted 976
8 SASI_Hs01_00023457 predicted 620
9 SASI_Hs01_00023458 predicted 474
10 SASI_Hs01_00023459 predicted 542
11 SASI_Hs01_00023455 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152379
VALIDATED
C1orf131 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 131
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-133s1c1
Sequence:CCGGGCTCCAGAACCTTTACGACTTCTCGAGAAGTCGTAAAGGTTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-296s1c1
Sequence:CCGGGCTTCGAGCTTCTTCAAGGAACTCGAGTTCCTTGAAGAAGCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152379.2-1113s1c1
Sequence:CCGGCCAGTGCAGCATGAATGTGAACTCGAGTTCACATTCATGCTGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-1167s1c1
Sequence:CCGGCCAGCAAACTTCACTCCTGTTCTCGAGAACAGGAGTGAAGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-566s1c1
Sequence:CCGGCGGTTTGGTATCACGGGTTATCTCGAGATAACCCGTGATACCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152379.2-314s1c1
Sequence:CCGGGAACTTAGAGAAGAGCGGCATCTCGAGATGCCGCTCTTCTCTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-425s1c1
Sequence:CCGGGTGGTAGAATTTCACAGCAATCTCGAGATTGCTGTGAAATTCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152379.2-509s1c1
Sequence:CCGGGAGAGAGATGTGGATACACAACTCGAGTTGTGTATCCACATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152379.2-998s1c1
Sequence:CCGGGATCGTTCTTAACACGCATTTCTCGAGAAATGCGTGTTAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152379.2-509s21c1
Sequence:CCGGGAGAGAGATGTGGATACACAACTCGAGTTGTGTATCCACATCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152379.2-998s21c1
Sequence:CCGGGATCGTTCTTAACACGCATTTCTCGAGAAATGCGTGTTAAGAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152379.2-1167s21c1
Sequence:CCGGCCAGCAAACTTCACTCCTGTTCTCGAGAACAGGAGTGAAGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152379.2-133s21c1
Sequence:CCGGGCTCCAGAACCTTTACGACTTCTCGAGAAGTCGTAAAGGTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152379
VALIDATED
C1orf131 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 131
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-133s1c1
Sequence:CCGGGCTCCAGAACCTTTACGACTTCTCGAGAAGTCGTAAAGGTTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-296s1c1
Sequence:CCGGGCTTCGAGCTTCTTCAAGGAACTCGAGTTCCTTGAAGAAGCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152379.2-1113s1c1
Sequence:CCGGCCAGTGCAGCATGAATGTGAACTCGAGTTCACATTCATGCTGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-1167s1c1
Sequence:CCGGCCAGCAAACTTCACTCCTGTTCTCGAGAACAGGAGTGAAGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-566s1c1
Sequence:CCGGCGGTTTGGTATCACGGGTTATCTCGAGATAACCCGTGATACCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152379.2-314s1c1
Sequence:CCGGGAACTTAGAGAAGAGCGGCATCTCGAGATGCCGCTCTTCTCTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-425s1c1
Sequence:CCGGGTGGTAGAATTTCACAGCAATCTCGAGATTGCTGTGAAATTCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152379.2-509s1c1
Sequence:CCGGGAGAGAGATGTGGATACACAACTCGAGTTGTGTATCCACATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152379.2-998s1c1
Sequence:CCGGGATCGTTCTTAACACGCATTTCTCGAGAAATGCGTGTTAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152379.2-509s21c1
Sequence:CCGGGAGAGAGATGTGGATACACAACTCGAGTTGTGTATCCACATCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152379.2-998s21c1
Sequence:CCGGGATCGTTCTTAACACGCATTTCTCGAGAAATGCGTGTTAAGAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152379.2-1167s21c1
Sequence:CCGGCCAGCAAACTTCACTCCTGTTCTCGAGAACAGGAGTGAAGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152379.2-133s21c1
Sequence:CCGGGCTCCAGAACCTTTACGACTTCTCGAGAAGTCGTAAAGGTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152379
VALIDATED
C1orf131 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 131
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-133s1c1
Sequence:CCGGGCTCCAGAACCTTTACGACTTCTCGAGAAGTCGTAAAGGTTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-296s1c1
Sequence:CCGGGCTTCGAGCTTCTTCAAGGAACTCGAGTTCCTTGAAGAAGCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152379.2-1113s1c1
Sequence:CCGGCCAGTGCAGCATGAATGTGAACTCGAGTTCACATTCATGCTGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-1167s1c1
Sequence:CCGGCCAGCAAACTTCACTCCTGTTCTCGAGAACAGGAGTGAAGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-566s1c1
Sequence:CCGGCGGTTTGGTATCACGGGTTATCTCGAGATAACCCGTGATACCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152379.2-314s1c1
Sequence:CCGGGAACTTAGAGAAGAGCGGCATCTCGAGATGCCGCTCTTCTCTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152379.2-425s1c1
Sequence:CCGGGTGGTAGAATTTCACAGCAATCTCGAGATTGCTGTGAAATTCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152379.2-509s1c1
Sequence:CCGGGAGAGAGATGTGGATACACAACTCGAGTTGTGTATCCACATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152379.2-998s1c1
Sequence:CCGGGATCGTTCTTAACACGCATTTCTCGAGAAATGCGTGTTAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152379.2-509s21c1
Sequence:CCGGGAGAGAGATGTGGATACACAACTCGAGTTGTGTATCCACATCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152379.2-998s21c1
Sequence:CCGGGATCGTTCTTAACACGCATTTCTCGAGAAATGCGTGTTAAGAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152379.2-1167s21c1
Sequence:CCGGCCAGCAAACTTCACTCCTGTTCTCGAGAACAGGAGTGAAGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152379.2-133s21c1
Sequence:CCGGGCTCCAGAACCTTTACGACTTCTCGAGAAGTCGTAAAGGTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks