EMAIL THIS PAGE TO A FRIEND

C1orf137

chromosome 1 open reading frame 137

Species: Human C1orf137(388667)
UniProtKB ID: Q5JT78
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013643 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013643 Rosetta Predictions human pricing
XR_039900 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178237 predicted 313
2 SASI_Hs01_00178238 predicted 324
3 SASI_Hs01_00178239 predicted 104
4 SASI_Hs01_00178240 predicted 314
5 SASI_Hs01_00178241 predicted 307
6 SASI_Hs01_00178242 predicted 45
7 SASI_Hs01_00178243 predicted 114
8 SASI_Hs01_00178244 predicted 303
9 SASI_Hs01_00178245 predicted 104
10 SASI_Hs01_00178246 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514063 predicted 321
2 SASI_Hs02_00514064 predicted 298
3 SASI_Hs02_00514065 predicted 323
4 SASI_Hs02_00514066 predicted 33
5 SASI_Hs02_00514067 predicted 110
6 SASI_Hs02_00514068 predicted 320
7 SASI_Hs02_00514069 predicted 313
8 SASI_Hs02_00514070 predicted 49
9 SASI_Hs02_00514071 predicted 20
10 SASI_Hs02_00514072 predicted 113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013643
C1orf137 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 137
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000179581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-107s1c1
Sequence:CCGGGCTCATGGAGTATCCAAATGACTCGAGTCATTTGGATACTCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-121s1c1
Sequence:CCGGCAAATGAGGCAACATCACCATCTCGAGATGGTGATGTTGCCTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-226s1c1
Sequence:CCGGCCAACCTTGAGCAGTTGCTTTCTCGAGAAAGCAACTGCTCAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-103s1c1
Sequence:CCGGGTAGGCTCATGGAGTATCCAACTCGAGTTGGATACTCCATGAGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013643
C1orf137 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 137
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000179581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-107s1c1
Sequence:CCGGGCTCATGGAGTATCCAAATGACTCGAGTCATTTGGATACTCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-121s1c1
Sequence:CCGGCAAATGAGGCAACATCACCATCTCGAGATGGTGATGTTGCCTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-226s1c1
Sequence:CCGGCCAACCTTGAGCAGTTGCTTTCTCGAGAAAGCAACTGCTCAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-103s1c1
Sequence:CCGGGTAGGCTCATGGAGTATCCAACTCGAGTTGGATACTCCATGAGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013643
C1orf137 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 137
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000179581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-107s1c1
Sequence:CCGGGCTCATGGAGTATCCAAATGACTCGAGTCATTTGGATACTCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-121s1c1
Sequence:CCGGCAAATGAGGCAACATCACCATCTCGAGATGGTGATGTTGCCTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-226s1c1
Sequence:CCGGCCAACCTTGAGCAGTTGCTTTCTCGAGAAAGCAACTGCTCAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013643.1-103s1c1
Sequence:CCGGGTAGGCTCATGGAGTATCCAACTCGAGTTGGATACTCCATGAGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks