EMAIL THIS PAGE TO A FRIEND

C1orf140

13 Gene Product Result for
Species: Human C1orf140(400804)
UniProtKB ID: Q5VVS0, Q6ZR57
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010913 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176040 predicted 549
2 SASI_Hs01_00176041 predicted 782
3 SASI_Hs01_00176042 predicted 730
4 SASI_Hs01_00176043 predicted 737
5 SASI_Hs01_00176044 predicted 555
6 SASI_Hs01_00176045 predicted 507
7 SASI_Hs01_00176046 predicted 647
8 SASI_Hs01_00176047 predicted 466
9 SASI_Hs01_00176048 predicted 535
10 SASI_Hs01_00176049 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010913
C1orf140 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-422s1c1
Sequence:CCGGGAGAATGCAGAAGCTGGCAAACTCGAGTTTGCCAGCTTCTGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-413s1c1
Sequence:CCGGGCAGACAGAGAGAATGCAGAACTCGAGTTCTGCATTCTCTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-317s1c1
Sequence:CCGGCCAAACCACCGAACTGGATTTCTCGAGAAATCCAGTTCGGTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-550s1c1
Sequence:CCGGCAAGTGAAGGGCTGATGAGAACTCGAGTTCTCATCAGCCCTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-416s1c1
Sequence:CCGGGACAGAGAGAATGCAGAAGCTCTCGAGAGCTTCTGCATTCTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010913.2-761s1c1
Sequence:CCGGGCACAGTAACAGAAGTGAGAACTCGAGTTCTCACTTCTGTTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-275s1c1
Sequence:CCGGGCCTATGAACAAACACTTGTTCTCGAGAACAAGTGTTTGTTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-502s1c1
Sequence:CCGGCAGGTCTACGTGAAATAGTGTCTCGAGACACTATTTCACGTAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010913.2-1614s1c1
Sequence:CCGGGCCTATTACATTCCGCTCCTACTCGAGTAGGAGCGGAATGTAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010913
C1orf140 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-422s1c1
Sequence:CCGGGAGAATGCAGAAGCTGGCAAACTCGAGTTTGCCAGCTTCTGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-413s1c1
Sequence:CCGGGCAGACAGAGAGAATGCAGAACTCGAGTTCTGCATTCTCTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-317s1c1
Sequence:CCGGCCAAACCACCGAACTGGATTTCTCGAGAAATCCAGTTCGGTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-550s1c1
Sequence:CCGGCAAGTGAAGGGCTGATGAGAACTCGAGTTCTCATCAGCCCTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-416s1c1
Sequence:CCGGGACAGAGAGAATGCAGAAGCTCTCGAGAGCTTCTGCATTCTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010913.2-761s1c1
Sequence:CCGGGCACAGTAACAGAAGTGAGAACTCGAGTTCTCACTTCTGTTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-275s1c1
Sequence:CCGGGCCTATGAACAAACACTTGTTCTCGAGAACAAGTGTTTGTTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-502s1c1
Sequence:CCGGCAGGTCTACGTGAAATAGTGTCTCGAGACACTATTTCACGTAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010913.2-1614s1c1
Sequence:CCGGGCCTATTACATTCCGCTCCTACTCGAGTAGGAGCGGAATGTAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010913
C1orf140 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-422s1c1
Sequence:CCGGGAGAATGCAGAAGCTGGCAAACTCGAGTTTGCCAGCTTCTGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-413s1c1
Sequence:CCGGGCAGACAGAGAGAATGCAGAACTCGAGTTCTGCATTCTCTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-317s1c1
Sequence:CCGGCCAAACCACCGAACTGGATTTCTCGAGAAATCCAGTTCGGTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-550s1c1
Sequence:CCGGCAAGTGAAGGGCTGATGAGAACTCGAGTTCTCATCAGCCCTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-416s1c1
Sequence:CCGGGACAGAGAGAATGCAGAAGCTCTCGAGAGCTTCTGCATTCTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010913.2-761s1c1
Sequence:CCGGGCACAGTAACAGAAGTGAGAACTCGAGTTCTCACTTCTGTTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010913.2-275s1c1
Sequence:CCGGGCCTATGAACAAACACTTGTTCTCGAGAACAAGTGTTTGTTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010913.2-502s1c1
Sequence:CCGGCAGGTCTACGTGAAATAGTGTCTCGAGACACTATTTCACGTAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010913.2-1614s1c1
Sequence:CCGGGCCTATTACATTCCGCTCCTACTCGAGTAGGAGCGGAATGTAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks