EMAIL THIS PAGE TO A FRIEND

C1orf141

chromosome 1 open reading frame 141

66 Gene Product Result for
Species: Human C1orf141(400757)
UniProtKB ID: Q5JVX7, Q0P5P5, Q5JVX5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_375738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104341 MISSION® esiRNA esiRNA human C1orf141 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013674 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306449 predicted 1264
2 SASI_Hs01_00162150 predicted 1394
3 SASI_Hs02_00306450 predicted 1031
4 SASI_Hs01_00162152 predicted 976
5 SASI_Hs01_00162154 predicted 1004
6 SASI_Hs02_00306451 predicted 1035
7 SASI_Hs01_00162155 predicted 717
8 SASI_Hs01_00162156 predicted 1042
9 SASI_Hs01_00162157 predicted 944
10 SASI_Hs01_00162158 predicted 688
11 SASI_Hs01_00162151 predicted 684
12 SASI_Hs01_00162153 predicted 882
13 SASI_Hs01_00162159 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375738
C1orf141 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 141
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-851s1c1
Sequence:CCGGGTAAGTATAGGTCAGTAAGAACTCGAGTTCTTACTGACCTATACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-408s1c1
Sequence:CCGGGCCTGAACCTAGAAAGAGTAACTCGAGTTACTCTTTCTAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-1232s1c1
Sequence:CCGGGCCACACAACTGTAGATGATACTCGAGTATCATCTACAGTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-352s1c1
Sequence:CCGGGAAGACAAGTCATGCAGCATTCTCGAGAATGCTGCATGACTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-1450s1c1
Sequence:CCGGTCCAGTGCCTTACCTGTCAAACTCGAGTTTGACAGGTAAGGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375738
C1orf141 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 141
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-851s1c1
Sequence:CCGGGTAAGTATAGGTCAGTAAGAACTCGAGTTCTTACTGACCTATACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-408s1c1
Sequence:CCGGGCCTGAACCTAGAAAGAGTAACTCGAGTTACTCTTTCTAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-1232s1c1
Sequence:CCGGGCCACACAACTGTAGATGATACTCGAGTATCATCTACAGTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-352s1c1
Sequence:CCGGGAAGACAAGTCATGCAGCATTCTCGAGAATGCTGCATGACTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-1450s1c1
Sequence:CCGGTCCAGTGCCTTACCTGTCAAACTCGAGTTTGACAGGTAAGGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375738
C1orf141 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 141
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-851s1c1
Sequence:CCGGGTAAGTATAGGTCAGTAAGAACTCGAGTTCTTACTGACCTATACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-408s1c1
Sequence:CCGGGCCTGAACCTAGAAAGAGTAACTCGAGTTACTCTTTCTAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-1232s1c1
Sequence:CCGGGCCACACAACTGTAGATGATACTCGAGTATCATCTACAGTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-352s1c1
Sequence:CCGGGAAGACAAGTCATGCAGCATTCTCGAGAATGCTGCATGACTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375738.2-1450s1c1
Sequence:CCGGTCCAGTGCCTTACCTGTCAAACTCGAGTTTGACAGGTAAGGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks