EMAIL THIS PAGE TO A FRIEND

C1orf145

chromosome 1 open reading frame 145

17 Gene Product Result for
Species: Human C1orf145(574407)
UniProtKB ID: Q96MR7, Q5T438, Q8N372
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025495 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159101 MISSION® esiRNA esiRNA human C1orf145 (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025495 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026404 predicted 233
2 SASI_Hs01_00026405 predicted 1342
3 SASI_Hs01_00026406 predicted 1065
4 SASI_Hs01_00026407 predicted 1980
5 SASI_Hs01_00026408 predicted 2460
6 SASI_Hs01_00026409 predicted 1993
7 SASI_Hs01_00026410 predicted 2365
8 SASI_Hs01_00026411 predicted 1877
9 SASI_Hs01_00026412 predicted 1305
10 SASI_Hs01_00026413 predicted 2190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025495
C1orf145 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 145
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-2505s1c1
Sequence:CCGGCCCAGCTTTATTGAGTTATAACTCGAGTTATAACTCAATAAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-2232s1c1
Sequence:CCGGCCACAGAGATGTGACTGCTAACTCGAGTTAGCAGTCACATCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-1317s1c1
Sequence:CCGGCCCTGCAACGTATTTGTTGAACTCGAGTTCAACAAATACGTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-1903s1c1
Sequence:CCGGCCTCTGTATTCCAGGAGGAAACTCGAGTTTCCTCCTGGAATACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025495
C1orf145 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 145
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-2505s1c1
Sequence:CCGGCCCAGCTTTATTGAGTTATAACTCGAGTTATAACTCAATAAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-2232s1c1
Sequence:CCGGCCACAGAGATGTGACTGCTAACTCGAGTTAGCAGTCACATCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-1317s1c1
Sequence:CCGGCCCTGCAACGTATTTGTTGAACTCGAGTTCAACAAATACGTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-1903s1c1
Sequence:CCGGCCTCTGTATTCCAGGAGGAAACTCGAGTTTCCTCCTGGAATACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025495
C1orf145 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 145
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-2505s1c1
Sequence:CCGGCCCAGCTTTATTGAGTTATAACTCGAGTTATAACTCAATAAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-2232s1c1
Sequence:CCGGCCACAGAGATGTGACTGCTAACTCGAGTTAGCAGTCACATCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-1317s1c1
Sequence:CCGGCCCTGCAACGTATTTGTTGAACTCGAGTTCAACAAATACGTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025495.1-1903s1c1
Sequence:CCGGCCTCTGTATTCCAGGAGGAAACTCGAGTTTCCTCCTGGAATACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks