EMAIL THIS PAGE TO A FRIEND

C1orf146

chromosome 1 open reading frame 146

19 Gene Product Result for
Synonyms: RP11-163M2.4
UniProtKB ID: Q5VVC0, Q5VVC4
Gene ID:
chicken(770460) chromosome 8 open reading frame, human C1orf146
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700136 Anti-C1orf146 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012425 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012425 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159343 predicted 398
2 SASI_Hs01_00159344 predicted 396
3 SASI_Hs01_00159345 predicted 254
4 SASI_Hs01_00159346 predicted 404
5 SASI_Hs01_00159348 predicted 426
6 SASI_Hs01_00159349 predicted 444
7 SASI_Hs01_00159350 predicted 380
8 SASI_Hs01_00159351 predicted 413
9 SASI_Hs01_00159352 predicted 406
10 SASI_Hs02_00306143 predicted 420
11 SASI_Hs01_00159347 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012425
C1orf146 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 146
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-363s1c1
Sequence:CCGGGCCTGAAGAATGGAAACTGATCTCGAGATCAGTTTCCATTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-405s1c1
Sequence:CCGGCCTGGGTTGTAACTTACGAATCTCGAGATTCGTAAGTTACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-169s1c1
Sequence:CCGGCGAAGCCACAAAGTTCGATATCTCGAGATATCGAACTTTGTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-406s1c1
Sequence:CCGGCTGGGTTGTAACTTACGAATACTCGAGTATTCGTAAGTTACAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-480s1c1
Sequence:CCGGGACTACCTCCAAACCATACATCTCGAGATGTATGGTTTGGAGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-174s1c1
Sequence:CCGGCCACAAAGTTCGATATTCAGACTCGAGTCTGAATATCGAACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-427s1c1
Sequence:CCGGCTTCCAGTACACAACACAGTACTCGAGTACTGTGTTGTGTACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-184s1c1
Sequence:CCGGCGATATTCAGATTCAGTGGAACTCGAGTTCCACTGAATCTGAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-476s1c1
Sequence:CCGGCAAAGACTACCTCCAAACCATCTCGAGATGGTTTGGAGGTAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012425
C1orf146 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 146
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-363s1c1
Sequence:CCGGGCCTGAAGAATGGAAACTGATCTCGAGATCAGTTTCCATTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-405s1c1
Sequence:CCGGCCTGGGTTGTAACTTACGAATCTCGAGATTCGTAAGTTACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-169s1c1
Sequence:CCGGCGAAGCCACAAAGTTCGATATCTCGAGATATCGAACTTTGTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-406s1c1
Sequence:CCGGCTGGGTTGTAACTTACGAATACTCGAGTATTCGTAAGTTACAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-480s1c1
Sequence:CCGGGACTACCTCCAAACCATACATCTCGAGATGTATGGTTTGGAGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-174s1c1
Sequence:CCGGCCACAAAGTTCGATATTCAGACTCGAGTCTGAATATCGAACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-427s1c1
Sequence:CCGGCTTCCAGTACACAACACAGTACTCGAGTACTGTGTTGTGTACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-184s1c1
Sequence:CCGGCGATATTCAGATTCAGTGGAACTCGAGTTCCACTGAATCTGAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-476s1c1
Sequence:CCGGCAAAGACTACCTCCAAACCATCTCGAGATGGTTTGGAGGTAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012425
C1orf146 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 146
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-363s1c1
Sequence:CCGGGCCTGAAGAATGGAAACTGATCTCGAGATCAGTTTCCATTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-405s1c1
Sequence:CCGGCCTGGGTTGTAACTTACGAATCTCGAGATTCGTAAGTTACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-169s1c1
Sequence:CCGGCGAAGCCACAAAGTTCGATATCTCGAGATATCGAACTTTGTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-406s1c1
Sequence:CCGGCTGGGTTGTAACTTACGAATACTCGAGTATTCGTAAGTTACAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-480s1c1
Sequence:CCGGGACTACCTCCAAACCATACATCTCGAGATGTATGGTTTGGAGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-174s1c1
Sequence:CCGGCCACAAAGTTCGATATTCAGACTCGAGTCTGAATATCGAACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-427s1c1
Sequence:CCGGCTTCCAGTACACAACACAGTACTCGAGTACTGTGTTGTGTACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012425.1-184s1c1
Sequence:CCGGCGATATTCAGATTCAGTGGAACTCGAGTTCCACTGAATCTGAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012425.1-476s1c1
Sequence:CCGGCAAAGACTACCTCCAAACCATCTCGAGATGGTTTGGAGGTAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks