EMAIL THIS PAGE TO A FRIEND

C1orf147

chromosome 1 open reading frame 147

43 Gene Product Result for
Species: Human C1orf147(574431)
UniProtKB ID: Q96MC9, Q5JTS5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025592 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125191 MISSION® esiRNA esiRNA human C1orf147 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025592 Rosetta Predictions human pricing
XR_039849 Rosetta Predictions human pricing
XR_039850 Rosetta Predictions human pricing
XR_039851 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196346 predicted 211
2 SASI_Hs01_00196347 predicted 364
3 SASI_Hs01_00196348 predicted 411
4 SASI_Hs01_00196349 predicted 353
5 SASI_Hs01_00196350 predicted 204
6 SASI_Hs01_00196351 predicted 924
7 SASI_Hs01_00196352 predicted 53
8 SASI_Hs01_00196353 predicted 904
9 SASI_Hs01_00196354 predicted 554
10 SASI_Hs01_00196355 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513632 predicted 246
2 SASI_Hs02_00513633 predicted 240
3 SASI_Hs02_00513634 predicted 402
4 SASI_Hs02_00513635 predicted 341
5 SASI_Hs02_00513636 predicted 244
6 SASI_Hs02_00513637 predicted 405
7 SASI_Hs02_00513638 predicted 400
8 SASI_Hs02_00513639 predicted 399
9 SASI_Hs02_00513640 predicted 235
10 SASI_Hs02_00513641 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513642 predicted 246
2 SASI_Hs02_00513643 predicted 241
3 SASI_Hs02_00513644 predicted 398
4 SASI_Hs02_00513645 predicted 346
5 SASI_Hs02_00513646 predicted 245
6 SASI_Hs02_00513647 predicted 401
7 SASI_Hs02_00513648 predicted 397
8 SASI_Hs02_00513649 predicted 403
9 SASI_Hs02_00513650 predicted 236
10 SASI_Hs02_00513651 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513652 predicted 245
2 SASI_Hs02_00513653 predicted 236
3 SASI_Hs02_00513654 predicted 394
4 SASI_Hs02_00513655 predicted 348
5 SASI_Hs02_00513656 predicted 246
6 SASI_Hs02_00513657 predicted 401
7 SASI_Hs02_00513658 predicted 399
8 SASI_Hs02_00513659 predicted 399
9 SASI_Hs02_00513660 predicted 238
10 SASI_Hs02_00513661 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025592
C1orf147 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 147
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025592.1-1161s1c1
Sequence:CCGGGCCACTTACTAGCCATGTGATCTCGAGATCACATGGCTAGTAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025592.1-715s1c1
Sequence:CCGGCCAGAGCAATTACACCAGAATCTCGAGATTCTGGTGTAATTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025592
C1orf147 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 147
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025592.1-1161s1c1
Sequence:CCGGGCCACTTACTAGCCATGTGATCTCGAGATCACATGGCTAGTAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025592.1-715s1c1
Sequence:CCGGCCAGAGCAATTACACCAGAATCTCGAGATTCTGGTGTAATTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025592
C1orf147 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 147
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025592.1-1161s1c1
Sequence:CCGGGCCACTTACTAGCCATGTGATCTCGAGATCACATGGCTAGTAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025592.1-715s1c1
Sequence:CCGGCCAGAGCAATTACACCAGAATCTCGAGATTCTGGTGTAATTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks