EMAIL THIS PAGE TO A FRIEND

C1orf158

chromosome 1 open reading frame 158

31 Gene Product Result for
Species: Human C1orf158(93190)
UniProtKB ID: Q8N1D5, Q5VUY4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152290 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047871 MISSION® esiRNA esiRNA human C1orf158 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152290 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208123 predicted 498
2 SASI_Hs01_00208124 predicted 399
3 SASI_Hs01_00208125 predicted 633
4 SASI_Hs01_00208126 predicted 678
5 SASI_Hs02_00365848 predicted 293
6 SASI_Hs01_00208127 predicted 663
7 SASI_Hs01_00208128 predicted 267
8 SASI_Hs01_00208129 predicted 644
9 SASI_Hs01_00208130 predicted 487
10 SASI_Hs01_00208131 predicted 686
11 SASI_Hs01_00208132 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152290
C1orf158 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 158
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152290.1-516s1c1
Sequence:CCGGCCATTACAACCGGCATGGTTACTCGAGTAACCATGCCGGTTGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152290.1-881s1c1
Sequence:CCGGGCAGATAAACTCAGAGTACGACTCGAGTCGTACTCTGAGTTTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152290.1-693s1c1
Sequence:CCGGGAGCACTTATACTTCATCCTACTCGAGTAGGATGAAGTATAAGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-924s1c1
Sequence:CCGGCTCAGAATCATCATCTGCATTCTCGAGAATGCAGATGATGATTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-819s1c1
Sequence:CCGGGCAGCTCAGATAGAATCAGCTCTCGAGAGCTGATTCTATCTGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-868s1c1
Sequence:CCGGGACAACAAGTGGCGCAGATAACTCGAGTTATCTGCGCCACTTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152290.2-897s21c1
Sequence:CCGGTACGAGATCTGGCCCGTCAAACTCGAGTTTGACGGGCCAGATCTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152290.2-264s21c1
Sequence:CCGGGCAGATTGAGACCAAGTATTCCTCGAGGAATACTTGGTCTCAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152290.2-502s21c1
Sequence:CCGGAGCACCTATGACGACCATTACCTCGAGGTAATGGTCGTCATAGGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152290
C1orf158 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 158
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152290.1-516s1c1
Sequence:CCGGCCATTACAACCGGCATGGTTACTCGAGTAACCATGCCGGTTGTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152290.1-881s1c1
Sequence:CCGGGCAGATAAACTCAGAGTACGACTCGAGTCGTACTCTGAGTTTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152290.1-693s1c1
Sequence:CCGGGAGCACTTATACTTCATCCTACTCGAGTAGGATGAAGTATAAGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-924s1c1
Sequence:CCGGCTCAGAATCATCATCTGCATTCTCGAGAATGCAGATGATGATTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-819s1c1
Sequence:CCGGGCAGCTCAGATAGAATCAGCTCTCGAGAGCTGATTCTATCTGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-868s1c1
Sequence:CCGGGACAACAAGTGGCGCAGATAACTCGAGTTATCTGCGCCACTTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152290.2-897s21c1
Sequence:CCGGTACGAGATCTGGCCCGTCAAACTCGAGTTTGACGGGCCAGATCTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152290.2-264s21c1
Sequence:CCGGGCAGATTGAGACCAAGTATTCCTCGAGGAATACTTGGTCTCAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152290.2-502s21c1
Sequence:CCGGAGCACCTATGACGACCATTACCTCGAGGTAATGGTCGTCATAGGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152290
C1orf158 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 158
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152290.1-516s1c1
Sequence:CCGGCCATTACAACCGGCATGGTTACTCGAGTAACCATGCCGGTTGTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152290.1-881s1c1
Sequence:CCGGGCAGATAAACTCAGAGTACGACTCGAGTCGTACTCTGAGTTTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152290.1-693s1c1
Sequence:CCGGGAGCACTTATACTTCATCCTACTCGAGTAGGATGAAGTATAAGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-924s1c1
Sequence:CCGGCTCAGAATCATCATCTGCATTCTCGAGAATGCAGATGATGATTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-819s1c1
Sequence:CCGGGCAGCTCAGATAGAATCAGCTCTCGAGAGCTGATTCTATCTGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152290.1-868s1c1
Sequence:CCGGGACAACAAGTGGCGCAGATAACTCGAGTTATCTGCGCCACTTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152290.2-897s21c1
Sequence:CCGGTACGAGATCTGGCCCGTCAAACTCGAGTTTGACGGGCCAGATCTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152290.2-264s21c1
Sequence:CCGGGCAGATTGAGACCAAGTATTCCTCGAGGAATACTTGGTCTCAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152290.2-502s21c1
Sequence:CCGGAGCACCTATGACGACCATTACCTCGAGGTAATGGTCGTCATAGGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)