EMAIL THIS PAGE TO A FRIEND

C1orf159

chromosome 1 open reading frame 159

35 Gene Product Result for
Species: Human C1orf159(54991)
UniProtKB ID: Q96HA4, B3KQ46, Q5T2W6, Q6UX67, Q6ZR77, Q9NWV0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115931 MISSION® esiRNA esiRNA human C1orf159 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114103 Rosetta Predictions human pricing
NM_017891 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326244 predicted 366
2 SASI_Hs02_00326245 predicted 1220
3 SASI_Hs02_00326246 predicted 1135
4 SASI_Hs02_00326247 predicted 535
5 SASI_Hs02_00326248 predicted 527
6 SASI_Hs02_00326249 predicted 1217
7 SASI_Hs02_00326250 predicted 1222
8 SASI_Hs02_00326251 predicted 1136
9 SASI_Hs02_00326252 predicted 459
10 SASI_Hs02_00326253 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350849 predicted 368
2 SASI_Hs01_00068209 predicted 1662
3 SASI_Hs02_00350850 predicted 1577
4 SASI_Hs02_00350851 predicted 529
5 SASI_Hs02_00350852 predicted 525
6 SASI_Hs01_00068210 predicted 1660
7 SASI_Hs01_00068211 predicted 1655
8 SASI_Hs01_00068214 predicted 1579
9 SASI_Hs02_00350853 predicted 458
10 SASI_Hs02_00350854 predicted 1550
11 SASI_Hs01_00068205 predicted 1798
12 SASI_Hs01_00068206 predicted 1440
13 SASI_Hs01_00068207 predicted 1701
14 SASI_Hs01_00068208 predicted 1699
15 SASI_Hs01_00068212 predicted 1442
16 SASI_Hs01_00068213 predicted 2161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017891
C1orf159 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 159
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017891.4-653s21c1
Sequence:CCGGACAACGGCTCCGAGTGTAGAACTCGAGTTCTACACTCGGAGCCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017891.4-827s21c1
Sequence:CCGGACCTCAAGCGCTCCAGTAAACCTCGAGGTTTACTGGAGCGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-1847s1c1
Sequence:CCGGCCCGTGACTTCCATGCTCTTTCTCGAGAAAGAGCATGGAAGTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-2783s1c1
Sequence:CCGGCAGAAATTCATTGTGCAGAAACTCGAGTTTCTGCACAATGAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-2757s1c1
Sequence:CCGGGCTTCCTCTTGATCTCTGTTTCTCGAGAAACAGAGATCAAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-1794s1c1
Sequence:CCGGCTCTGGATCTCAGCTGGATTTCTCGAGAAATCCAGCTGAGATCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017891
C1orf159 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 159
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017891.4-653s21c1
Sequence:CCGGACAACGGCTCCGAGTGTAGAACTCGAGTTCTACACTCGGAGCCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017891.4-827s21c1
Sequence:CCGGACCTCAAGCGCTCCAGTAAACCTCGAGGTTTACTGGAGCGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-1847s1c1
Sequence:CCGGCCCGTGACTTCCATGCTCTTTCTCGAGAAAGAGCATGGAAGTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-2783s1c1
Sequence:CCGGCAGAAATTCATTGTGCAGAAACTCGAGTTTCTGCACAATGAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-2757s1c1
Sequence:CCGGGCTTCCTCTTGATCTCTGTTTCTCGAGAAACAGAGATCAAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-1794s1c1
Sequence:CCGGCTCTGGATCTCAGCTGGATTTCTCGAGAAATCCAGCTGAGATCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017891
C1orf159 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 159
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017891.4-653s21c1
Sequence:CCGGACAACGGCTCCGAGTGTAGAACTCGAGTTCTACACTCGGAGCCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017891.4-827s21c1
Sequence:CCGGACCTCAAGCGCTCCAGTAAACCTCGAGGTTTACTGGAGCGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-1847s1c1
Sequence:CCGGCCCGTGACTTCCATGCTCTTTCTCGAGAAAGAGCATGGAAGTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-2783s1c1
Sequence:CCGGCAGAAATTCATTGTGCAGAAACTCGAGTTTCTGCACAATGAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-2757s1c1
Sequence:CCGGGCTTCCTCTTGATCTCTGTTTCTCGAGAAACAGAGATCAAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017891.2-1794s1c1
Sequence:CCGGCTCTGGATCTCAGCTGGATTTCTCGAGAAATCCAGCTGAGATCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks