EMAIL THIS PAGE TO A FRIEND

C1orf162

chromosome 1 open reading frame 162

35 Gene Product Result for
Species: Human C1orf162(128346)
UniProtKB ID: Q8NEQ5, Q5QNZ1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174896 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140411 MISSION® esiRNA esiRNA human C1orf162 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174896 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040497 predicted 631
2 SASI_Hs01_00040498 predicted 669
3 SASI_Hs01_00040500 predicted 626
4 SASI_Hs01_00040501 predicted 663
5 SASI_Hs01_00040502 predicted 371
6 SASI_Hs01_00040503 predicted 459
7 SASI_Hs01_00040504 predicted 468
8 SASI_Hs02_00368782 predicted 407
9 SASI_Hs01_00040505 predicted 678
10 SASI_Hs01_00040506 predicted 647
11 SASI_Hs01_00040499 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174896
C1orf162 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 162
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-469s1c1
Sequence:CCGGGAGAACCATTCTGCAGACTTTCTCGAGAAAGTCTGCAGAATGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-222s1c1
Sequence:CCGGGATAGCCTTTATCTTCCTCATCTCGAGATGAGGAAGATAAAGGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-422s1c1
Sequence:CCGGCCAGCACAACTTTCAAACTCTCTCGAGAGAGTTTGAAAGTTGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-417s1c1
Sequence:CCGGCTATGCCAGCACAACTTTCAACTCGAGTTGAAAGTTGTGCTGGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-216s1c1
Sequence:CCGGGCTGCTGATAGCCTTTATCTTCTCGAGAAGATAAAGGCTATCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174896.2-664s1c1
Sequence:CCGGGCAATGCTATCCAGCATCTTTCTCGAGAAAGATGCTGGATAGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-95s1c1
Sequence:CCGGCTGAAAGACAAGGCACTCTCTCTCGAGAGAGAGTGCCTTGTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-471s1c1
Sequence:CCGGGAACCATTCTGCAGACTTTGACTCGAGTCAAAGTCTGCAGAATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-453s1c1
Sequence:CCGGGAGCAATCACTTGGCTGAGAACTCGAGTTCTCAGCCAAGTGATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174896
C1orf162 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 162
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-469s1c1
Sequence:CCGGGAGAACCATTCTGCAGACTTTCTCGAGAAAGTCTGCAGAATGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-222s1c1
Sequence:CCGGGATAGCCTTTATCTTCCTCATCTCGAGATGAGGAAGATAAAGGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-422s1c1
Sequence:CCGGCCAGCACAACTTTCAAACTCTCTCGAGAGAGTTTGAAAGTTGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-417s1c1
Sequence:CCGGCTATGCCAGCACAACTTTCAACTCGAGTTGAAAGTTGTGCTGGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-216s1c1
Sequence:CCGGGCTGCTGATAGCCTTTATCTTCTCGAGAAGATAAAGGCTATCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174896.2-664s1c1
Sequence:CCGGGCAATGCTATCCAGCATCTTTCTCGAGAAAGATGCTGGATAGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-95s1c1
Sequence:CCGGCTGAAAGACAAGGCACTCTCTCTCGAGAGAGAGTGCCTTGTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-471s1c1
Sequence:CCGGGAACCATTCTGCAGACTTTGACTCGAGTCAAAGTCTGCAGAATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-453s1c1
Sequence:CCGGGAGCAATCACTTGGCTGAGAACTCGAGTTCTCAGCCAAGTGATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174896
C1orf162 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 162
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-469s1c1
Sequence:CCGGGAGAACCATTCTGCAGACTTTCTCGAGAAAGTCTGCAGAATGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-222s1c1
Sequence:CCGGGATAGCCTTTATCTTCCTCATCTCGAGATGAGGAAGATAAAGGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-422s1c1
Sequence:CCGGCCAGCACAACTTTCAAACTCTCTCGAGAGAGTTTGAAAGTTGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-417s1c1
Sequence:CCGGCTATGCCAGCACAACTTTCAACTCGAGTTGAAAGTTGTGCTGGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174896.2-216s1c1
Sequence:CCGGGCTGCTGATAGCCTTTATCTTCTCGAGAAGATAAAGGCTATCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174896.2-664s1c1
Sequence:CCGGGCAATGCTATCCAGCATCTTTCTCGAGAAAGATGCTGGATAGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-95s1c1
Sequence:CCGGCTGAAAGACAAGGCACTCTCTCTCGAGAGAGAGTGCCTTGTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-471s1c1
Sequence:CCGGGAACCATTCTGCAGACTTTGACTCGAGTCAAAGTCTGCAGAATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174896.2-453s1c1
Sequence:CCGGGAGCAATCACTTGGCTGAGAACTCGAGTTCTCAGCCAAGTGATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)