EMAIL THIS PAGE TO A FRIEND

C1orf168

chromosome 1 open reading frame 168

61 Gene Product Result for
Species: Human C1orf168(199920)
UniProtKB ID: Q5VWT5, Q63HM3, Q6ZUY6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004303 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015131 MISSION® esiRNA esiRNA targeting human C1orf168 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304499 predicted 1694
2 SASI_Hs02_00304500 predicted 426
3 SASI_Hs01_00206065 predicted 755
4 SASI_Hs01_00206066 predicted 589
5 SASI_Hs01_00206067 predicted 2622
6 SASI_Hs02_00304501 predicted 756
7 SASI_Hs02_00304502 predicted 1514
8 SASI_Hs01_00206068 predicted 2616
9 SASI_Hs01_00206069 predicted 2651
10 SASI_Hs02_00304503 predicted 1633
11 SASI_Hs01_00206064 predicted 2248
12 SASI_Hs01_00206070 predicted 383
13 SASI_Hs01_00206071 predicted 1668
14 SASI_Hs01_00206072 predicted 1517
15 SASI_Hs01_00206073 predicted 2290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004303
C1orf168 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 168
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-556s1c1
Sequence:CCGGCCTTGCCAACTATGGAAGTAACTCGAGTTACTTCCATAGTTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004303.2-1072s1c1
Sequence:CCGGCGAGGCAACAATTTCATATCTCTCGAGAGATATGAAATTGTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-1801s1c1
Sequence:CCGGGCTGCCTGATTTAGAACTTAACTCGAGTTAAGTTCTAAATCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-512s1c1
Sequence:CCGGGAGAAGGTTTCATCTCAGAAACTCGAGTTTCTGAGATGAAACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-479s1c1
Sequence:CCGGGCCAATAGCTTCAGAAACAAACTCGAGTTTGTTTCTGAAGCTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004303.2-396s1c1
Sequence:CCGGCAACAAGTTCACAGAAGGCTTCTCGAGAAGCCTTCTGTGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-267s1c1
Sequence:CCGGGCACACCATACTGTTCCAGTACTCGAGTACTGGAACAGTATGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004303
C1orf168 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 168
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-556s1c1
Sequence:CCGGCCTTGCCAACTATGGAAGTAACTCGAGTTACTTCCATAGTTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004303.2-1072s1c1
Sequence:CCGGCGAGGCAACAATTTCATATCTCTCGAGAGATATGAAATTGTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-1801s1c1
Sequence:CCGGGCTGCCTGATTTAGAACTTAACTCGAGTTAAGTTCTAAATCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-512s1c1
Sequence:CCGGGAGAAGGTTTCATCTCAGAAACTCGAGTTTCTGAGATGAAACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-479s1c1
Sequence:CCGGGCCAATAGCTTCAGAAACAAACTCGAGTTTGTTTCTGAAGCTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004303.2-396s1c1
Sequence:CCGGCAACAAGTTCACAGAAGGCTTCTCGAGAAGCCTTCTGTGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-267s1c1
Sequence:CCGGGCACACCATACTGTTCCAGTACTCGAGTACTGGAACAGTATGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004303
C1orf168 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 168
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-556s1c1
Sequence:CCGGCCTTGCCAACTATGGAAGTAACTCGAGTTACTTCCATAGTTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004303.2-1072s1c1
Sequence:CCGGCGAGGCAACAATTTCATATCTCTCGAGAGATATGAAATTGTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-1801s1c1
Sequence:CCGGGCTGCCTGATTTAGAACTTAACTCGAGTTAAGTTCTAAATCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-512s1c1
Sequence:CCGGGAGAAGGTTTCATCTCAGAAACTCGAGTTTCTGAGATGAAACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-479s1c1
Sequence:CCGGGCCAATAGCTTCAGAAACAAACTCGAGTTTGTTTCTGAAGCTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004303.2-396s1c1
Sequence:CCGGCAACAAGTTCACAGAAGGCTTCTCGAGAAGCCTTCTGTGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004303.2-267s1c1
Sequence:CCGGGCACACCATACTGTTCCAGTACTCGAGTACTGGAACAGTATGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks