EMAIL THIS PAGE TO A FRIEND

C1orf172

chromosome 1 open reading frame 172

32 Gene Product Result for
Synonyms: RP11-344H11.3
Species: Human C1orf172(126695)
UniProtKB ID: Q8NAX2, Q5QP32, Q8N0S7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152365 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048231 MISSION® esiRNA esiRNA human C1orf172 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152365 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207231 predicted 864
2 SASI_Hs02_00366013 predicted 986
3 SASI_Hs01_00207232 predicted 248
4 SASI_Hs01_00207233 predicted 246
5 SASI_Hs01_00207234 predicted 825
6 SASI_Hs01_00207235 predicted 1536
7 SASI_Hs01_00207236 predicted 1170
8 SASI_Hs01_00207237 predicted 902
9 SASI_Hs01_00207238 predicted 1424
10 SASI_Hs01_00207240 predicted 1313
11 SASI_Hs01_00207239 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152365
C1orf172 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 172
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-729s1c1
Sequence:CCGGGAGGAGTACTATTCTTTCCATCTCGAGATGGAAAGAATAGTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1548s1c1
Sequence:CCGGGAAAGTAAGGAGTTAGGCATTCTCGAGAATGCCTAACTCCTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1541s1c1
Sequence:CCGGGATCATGGAAAGTAAGGAGTTCTCGAGAACTCCTTACTTTCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1564s1c1
Sequence:CCGGGCATTACCTTCTGGGAGTGAACTCGAGTTCACTCCCAGAAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-259s1c1
Sequence:CCGGGCATTACCTTCATCTCTGGCTCTCGAGAGCCAGAGATGAAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-794s1c1
Sequence:CCGGGAGCCGAGAAATTGATGTGCTCTCGAGAGCACATCAATTTCTCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-157s1c1
Sequence:CCGGCAGAGCTATGTCTGGAGACATCTCGAGATGTCTCCAGACATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152365.1-1607s1c1
Sequence:CCGGCCACCCTAACCAATCATGCAACTCGAGTTGCATGATTGGTTAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-904s1c1
Sequence:CCGGCCAGTAAGATCTCGGACCTTACTCGAGTAAGGTCCGAGATCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-821s1c1
Sequence:CCGGCAAGAAGCTGACAGAGCTGTTCTCGAGAACAGCTCTGTCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-985s1c1
Sequence:CCGGGCGGCATCATTCGCATTAGTACTCGAGTACTAATGCGAATGATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152365
C1orf172 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 172
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-729s1c1
Sequence:CCGGGAGGAGTACTATTCTTTCCATCTCGAGATGGAAAGAATAGTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1548s1c1
Sequence:CCGGGAAAGTAAGGAGTTAGGCATTCTCGAGAATGCCTAACTCCTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1541s1c1
Sequence:CCGGGATCATGGAAAGTAAGGAGTTCTCGAGAACTCCTTACTTTCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1564s1c1
Sequence:CCGGGCATTACCTTCTGGGAGTGAACTCGAGTTCACTCCCAGAAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-259s1c1
Sequence:CCGGGCATTACCTTCATCTCTGGCTCTCGAGAGCCAGAGATGAAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-794s1c1
Sequence:CCGGGAGCCGAGAAATTGATGTGCTCTCGAGAGCACATCAATTTCTCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-157s1c1
Sequence:CCGGCAGAGCTATGTCTGGAGACATCTCGAGATGTCTCCAGACATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152365.1-1607s1c1
Sequence:CCGGCCACCCTAACCAATCATGCAACTCGAGTTGCATGATTGGTTAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-904s1c1
Sequence:CCGGCCAGTAAGATCTCGGACCTTACTCGAGTAAGGTCCGAGATCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-821s1c1
Sequence:CCGGCAAGAAGCTGACAGAGCTGTTCTCGAGAACAGCTCTGTCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-985s1c1
Sequence:CCGGGCGGCATCATTCGCATTAGTACTCGAGTACTAATGCGAATGATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152365
C1orf172 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 172
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-729s1c1
Sequence:CCGGGAGGAGTACTATTCTTTCCATCTCGAGATGGAAAGAATAGTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1548s1c1
Sequence:CCGGGAAAGTAAGGAGTTAGGCATTCTCGAGAATGCCTAACTCCTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1541s1c1
Sequence:CCGGGATCATGGAAAGTAAGGAGTTCTCGAGAACTCCTTACTTTCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152365.1-1564s1c1
Sequence:CCGGGCATTACCTTCTGGGAGTGAACTCGAGTTCACTCCCAGAAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-259s1c1
Sequence:CCGGGCATTACCTTCATCTCTGGCTCTCGAGAGCCAGAGATGAAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-794s1c1
Sequence:CCGGGAGCCGAGAAATTGATGTGCTCTCGAGAGCACATCAATTTCTCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-157s1c1
Sequence:CCGGCAGAGCTATGTCTGGAGACATCTCGAGATGTCTCCAGACATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152365.1-1607s1c1
Sequence:CCGGCCACCCTAACCAATCATGCAACTCGAGTTGCATGATTGGTTAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-904s1c1
Sequence:CCGGCCAGTAAGATCTCGGACCTTACTCGAGTAAGGTCCGAGATCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152365.1-821s1c1
Sequence:CCGGCAAGAAGCTGACAGAGCTGTTCTCGAGAACAGCTCTGTCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152365.1-985s1c1
Sequence:CCGGGCGGCATCATTCGCATTAGTACTCGAGTACTAATGCGAATGATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks