EMAIL THIS PAGE TO A FRIEND

C1orf173

chromosome 1 open reading frame 173

82 Gene Product Result for
Synonyms: RP11-653A5.1
Species: Human C1orf173(127254)
UniProtKB ID: Q5RHP9, Q68DL8, Q6GMR8, Q6ZSF9, Q8ND41
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002912 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002912 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210259 predicted 2395
2 SASI_Hs01_00210260 predicted 542
3 SASI_Hs02_00304258 predicted 2438
4 SASI_Hs02_00304259 predicted 379
5 SASI_Hs01_00210261 predicted 3367
6 SASI_Hs01_00210262 predicted 739
7 SASI_Hs01_00210263 predicted 4678
8 SASI_Hs01_00210264 predicted 724
9 SASI_Hs01_00210265 predicted 2251
10 SASI_Hs01_00210266 predicted 4669
11 SASI_Hs01_00210267 predicted 613
12 SASI_Hs01_00210268 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002912
C1orf173 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 173
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002912.2-2660s1c1
Sequence:CCGGCCGAGAGAAGCAACAGCATATCTCGAGATATGCTGTTGCTTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1038s21c1
Sequence:CCGGGGATTCAAGAAGGATTCATAACTCGAGTTATGAATCCTTCTTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1081s21c1
Sequence:CCGGGCTATTACAATGATCTATTTGCTCGAGCAAATAGATCATTGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-3648s21c1
Sequence:CCGGTCTAGGAGAAGATTCACTAAACTCGAGTTTAGTGAATCTTCTCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002912.3-4818s21c1
Sequence:CCGGTTGCTGGCAGACGGATAATTTCTCGAGAAATTATCCGTCTGCCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1970s21c1
Sequence:CCGGCATCCAGAAGTCACCCTTATTCTCGAGAATAAGGGTGACTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002912
C1orf173 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 173
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002912.2-2660s1c1
Sequence:CCGGCCGAGAGAAGCAACAGCATATCTCGAGATATGCTGTTGCTTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1038s21c1
Sequence:CCGGGGATTCAAGAAGGATTCATAACTCGAGTTATGAATCCTTCTTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1081s21c1
Sequence:CCGGGCTATTACAATGATCTATTTGCTCGAGCAAATAGATCATTGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-3648s21c1
Sequence:CCGGTCTAGGAGAAGATTCACTAAACTCGAGTTTAGTGAATCTTCTCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002912.3-4818s21c1
Sequence:CCGGTTGCTGGCAGACGGATAATTTCTCGAGAAATTATCCGTCTGCCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1970s21c1
Sequence:CCGGCATCCAGAAGTCACCCTTATTCTCGAGAATAAGGGTGACTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002912
C1orf173 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 173
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002912.2-2660s1c1
Sequence:CCGGCCGAGAGAAGCAACAGCATATCTCGAGATATGCTGTTGCTTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1038s21c1
Sequence:CCGGGGATTCAAGAAGGATTCATAACTCGAGTTATGAATCCTTCTTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1081s21c1
Sequence:CCGGGCTATTACAATGATCTATTTGCTCGAGCAAATAGATCATTGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-3648s21c1
Sequence:CCGGTCTAGGAGAAGATTCACTAAACTCGAGTTTAGTGAATCTTCTCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002912.3-4818s21c1
Sequence:CCGGTTGCTGGCAGACGGATAATTTCTCGAGAAATTATCCGTCTGCCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002912.3-1970s21c1
Sequence:CCGGCATCCAGAAGTCACCCTTATTCTCGAGAATAAGGGTGACTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks