EMAIL THIS PAGE TO A FRIEND

C1orf174

chromosome 1 open reading frame 174

33 Gene Product Result for
Synonyms: RP13-531C17.2
Species: Human C1orf174(339448)
UniProtKB ID: Q8IYL3, A8K0C8, A8MUG9, Q5SR20, Q6NX36
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_290902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290902 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101211 MISSION® esiRNA esiRNA human C1orf174 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063656 predicted 217
2 SASI_Hs01_00063658 predicted 480
3 SASI_Hs01_00063659 predicted 307
4 SASI_Hs01_00063660 predicted 213
5 SASI_Hs01_00063661 predicted 286
6 SASI_Hs01_00063662 predicted 210
7 SASI_Hs01_00063663 predicted 251
8 SASI_Hs01_00063665 predicted 569
9 SASI_Hs02_00373913 predicted 272
10 SASI_Hs02_00373914 predicted 214
11 SASI_Hs01_00063657 predicted 308
12 SASI_Hs01_00063664 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207356
VALIDATED
C1orf174 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 174
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000352422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207356.2-268s21c1
Sequence:CCGGGAACGTCCAAGAAGTTCAAATCTCGAGATTTGAACTTCTTGGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_207356.2-818s21c1
Sequence:CCGGCGACGATGATGCAGAAATGTACTCGAGTACATTTCTGCATCATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_207356.2-488s21c1
Sequence:CCGGGAGTGACTCTCGCTTAGCAAACTCGAGTTTGCTAAGCGAGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207356.2-1497s21c1
Sequence:CCGGGCTTTGGTCATAGGCAAGTTTCTCGAGAAACTTGCCTATGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207356
VALIDATED
C1orf174 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 174
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000352422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207356.2-268s21c1
Sequence:CCGGGAACGTCCAAGAAGTTCAAATCTCGAGATTTGAACTTCTTGGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_207356.2-818s21c1
Sequence:CCGGCGACGATGATGCAGAAATGTACTCGAGTACATTTCTGCATCATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_207356.2-488s21c1
Sequence:CCGGGAGTGACTCTCGCTTAGCAAACTCGAGTTTGCTAAGCGAGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207356.2-1497s21c1
Sequence:CCGGGCTTTGGTCATAGGCAAGTTTCTCGAGAAACTTGCCTATGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207356
VALIDATED
C1orf174 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 174
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000352422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207356.2-268s21c1
Sequence:CCGGGAACGTCCAAGAAGTTCAAATCTCGAGATTTGAACTTCTTGGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_207356.2-818s21c1
Sequence:CCGGCGACGATGATGCAGAAATGTACTCGAGTACATTTCTGCATCATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_207356.2-488s21c1
Sequence:CCGGGAGTGACTCTCGCTTAGCAAACTCGAGTTTGCTAAGCGAGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207356.2-1497s21c1
Sequence:CCGGGCTTTGGTCATAGGCAAGTTTCTCGAGAAACTTGCCTATGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290902
VALIDATED
C1orf174 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 174
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-143s1c1
Sequence:CCGGCGCTTGAAAGCACGAAGTTGTCTCGAGACAACTTCGTGCTTTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_290902.3-481s1c1
Sequence:CCGGGAGTGACTCTCGCTTAGCAAACTCGAGTTTGCTAAGCGAGAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290902.3-800s1c1
Sequence:CCGGGATGATGACGACGACGATGATCTCGAGATCATCGTCGTCGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-811s1c1
Sequence:CCGGCGACGATGATGCAGAAATGTACTCGAGTACATTTCTGCATCATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290902.3-1490s1c1
Sequence:CCGGGCTTTGGTCATAGGCAAGTTTCTCGAGAAACTTGCCTATGACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290902.3-144s1c1
Sequence:CCGGGCTTGAAAGCACGAAGTTGTTCTCGAGAACAACTTCGTGCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-260s1c1
Sequence:CCGGCGAACGTCCAAGAAGTTCAAACTCGAGTTTGAACTTCTTGGACGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290902
VALIDATED
C1orf174 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 174
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-143s1c1
Sequence:CCGGCGCTTGAAAGCACGAAGTTGTCTCGAGACAACTTCGTGCTTTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_290902.3-481s1c1
Sequence:CCGGGAGTGACTCTCGCTTAGCAAACTCGAGTTTGCTAAGCGAGAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290902.3-800s1c1
Sequence:CCGGGATGATGACGACGACGATGATCTCGAGATCATCGTCGTCGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-811s1c1
Sequence:CCGGCGACGATGATGCAGAAATGTACTCGAGTACATTTCTGCATCATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290902.3-1490s1c1
Sequence:CCGGGCTTTGGTCATAGGCAAGTTTCTCGAGAAACTTGCCTATGACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290902.3-144s1c1
Sequence:CCGGGCTTGAAAGCACGAAGTTGTTCTCGAGAACAACTTCGTGCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-260s1c1
Sequence:CCGGCGAACGTCCAAGAAGTTCAAACTCGAGTTTGAACTTCTTGGACGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290902
VALIDATED
C1orf174 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 174
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-143s1c1
Sequence:CCGGCGCTTGAAAGCACGAAGTTGTCTCGAGACAACTTCGTGCTTTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_290902.3-481s1c1
Sequence:CCGGGAGTGACTCTCGCTTAGCAAACTCGAGTTTGCTAAGCGAGAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290902.3-800s1c1
Sequence:CCGGGATGATGACGACGACGATGATCTCGAGATCATCGTCGTCGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-811s1c1
Sequence:CCGGCGACGATGATGCAGAAATGTACTCGAGTACATTTCTGCATCATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290902.3-1490s1c1
Sequence:CCGGGCTTTGGTCATAGGCAAGTTTCTCGAGAAACTTGCCTATGACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290902.3-144s1c1
Sequence:CCGGGCTTGAAAGCACGAAGTTGTTCTCGAGAACAACTTCGTGCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290902.3-260s1c1
Sequence:CCGGCGAACGTCCAAGAAGTTCAAACTCGAGTTTGAACTTCTTGGACGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks