EMAIL THIS PAGE TO A FRIEND

C1orf177

chromosome 1 open reading frame 177

50 Gene Product Result for
Species: Human C1orf177(163747)
UniProtKB ID: Q3ZCV2, B7WPL2, Q8N7Y9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031631 MISSION® esiRNA esiRNA human C1orf177 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110533 Rosetta Predictions human pricing
NM_152607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325005 predicted 429
2 SASI_Hs02_00325006 predicted 218
3 SASI_Hs02_00325007 predicted 1479
4 SASI_Hs02_00325008 predicted 429
5 SASI_Hs02_00325009 predicted 242
6 SASI_Hs02_00325010 predicted 587
7 SASI_Hs02_00325011 predicted 279
8 SASI_Hs02_00325012 predicted 373
9 SASI_Hs02_00325013 predicted 256
10 SASI_Hs02_00325014 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105604 predicted 427
2 SASI_Hs01_00105598 predicted 223
3 SASI_Hs02_00366457 predicted 1569
4 SASI_Hs01_00105603 predicted 425
5 SASI_Hs01_00105599 predicted 247
6 SASI_Hs01_00105600 predicted 594
7 SASI_Hs01_00105601 predicted 279
8 SASI_Hs01_00105602 predicted 370
9 SASI_Hs01_00105605 predicted 254
10 SASI_Hs01_00105606 predicted 434
11 SASI_Hs01_00105597 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152607
C1orf177 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 177
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-754s1c1
Sequence:CCGGCCCTATGACACTTTCTCTGGTCTCGAGACCAGAGAAAGTGTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1079s1c1
Sequence:CCGGCCTGCCAGATGATTATGGGAACTCGAGTTCCCATAATCATCTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1175s1c1
Sequence:CCGGGATCCCTATTCCTGAGTGGATCTCGAGATCCACTCAGGAATAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1164s1c1
Sequence:CCGGGCAGCGATATCGATCCCTATTCTCGAGAATAGGGATCGATATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-825s1c1
Sequence:CCGGGCCCAGGGAACTGATGAATTTCTCGAGAAATTCATCAGTTCCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-567s1c1
Sequence:CCGGGAAGGGTAACCCATACACCAACTCGAGTTGGTGTATGGGTTACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152607.2-1325s21c1
Sequence:CCGGGGGAAAGGATCACACCATTTACTCGAGTAAATGGTGTGATCCTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152607.2-864s21c1
Sequence:CCGGACTTAACTCACATCACAATAACTCGAGTTATTGTGATGTGAGTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152607
C1orf177 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 177
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-754s1c1
Sequence:CCGGCCCTATGACACTTTCTCTGGTCTCGAGACCAGAGAAAGTGTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1079s1c1
Sequence:CCGGCCTGCCAGATGATTATGGGAACTCGAGTTCCCATAATCATCTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1175s1c1
Sequence:CCGGGATCCCTATTCCTGAGTGGATCTCGAGATCCACTCAGGAATAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1164s1c1
Sequence:CCGGGCAGCGATATCGATCCCTATTCTCGAGAATAGGGATCGATATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-825s1c1
Sequence:CCGGGCCCAGGGAACTGATGAATTTCTCGAGAAATTCATCAGTTCCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-567s1c1
Sequence:CCGGGAAGGGTAACCCATACACCAACTCGAGTTGGTGTATGGGTTACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152607.2-1325s21c1
Sequence:CCGGGGGAAAGGATCACACCATTTACTCGAGTAAATGGTGTGATCCTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152607.2-864s21c1
Sequence:CCGGACTTAACTCACATCACAATAACTCGAGTTATTGTGATGTGAGTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152607
C1orf177 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 177
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-754s1c1
Sequence:CCGGCCCTATGACACTTTCTCTGGTCTCGAGACCAGAGAAAGTGTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1079s1c1
Sequence:CCGGCCTGCCAGATGATTATGGGAACTCGAGTTCCCATAATCATCTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1175s1c1
Sequence:CCGGGATCCCTATTCCTGAGTGGATCTCGAGATCCACTCAGGAATAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-1164s1c1
Sequence:CCGGGCAGCGATATCGATCCCTATTCTCGAGAATAGGGATCGATATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-825s1c1
Sequence:CCGGGCCCAGGGAACTGATGAATTTCTCGAGAAATTCATCAGTTCCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152607.1-567s1c1
Sequence:CCGGGAAGGGTAACCCATACACCAACTCGAGTTGGTGTATGGGTTACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152607.2-1325s21c1
Sequence:CCGGGGGAAAGGATCACACCATTTACTCGAGTAAATGGTGTGATCCTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152607.2-864s21c1
Sequence:CCGGACTTAACTCACATCACAATAACTCGAGTTATTGTGATGTGAGTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks