EMAIL THIS PAGE TO A FRIEND

C1orf180

chromosome 1 open reading frame 180

Species: Human C1orf180(439927)
UniProtKB ID: Q8NAE3
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033660 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033660 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211668 predicted 854
2 SASI_Hs01_00211669 predicted 690
3 SASI_Hs01_00211670 predicted 1973
4 SASI_Hs01_00211671 predicted 2540
5 SASI_Hs01_00211672 predicted 2129
6 SASI_Hs01_00211673 predicted 1996
7 SASI_Hs01_00211674 predicted 1898
8 SASI_Hs01_00211675 predicted 2455
9 SASI_Hs01_00211676 predicted 2101
10 SASI_Hs01_00211677 predicted 2446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033660
C1orf180 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 180
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033660.1-418s1c1
Sequence:CCGGGTTTATTTCTAGCTATGCTGTCTCGAGACAGCATAGCTAGAAATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033660.1-2453s1c1
Sequence:CCGGCCTGCAAGTATCCAGAGAGTTCTCGAGAACTCTCTGGATACTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033660.1-2109s1c1
Sequence:CCGGCGTGGAATAATCAAAGCAAATCTCGAGATTTGCTTTGATTATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033660
C1orf180 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 180
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033660.1-418s1c1
Sequence:CCGGGTTTATTTCTAGCTATGCTGTCTCGAGACAGCATAGCTAGAAATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033660.1-2453s1c1
Sequence:CCGGCCTGCAAGTATCCAGAGAGTTCTCGAGAACTCTCTGGATACTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033660.1-2109s1c1
Sequence:CCGGCGTGGAATAATCAAAGCAAATCTCGAGATTTGCTTTGATTATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033660
C1orf180 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 180
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033660.1-418s1c1
Sequence:CCGGGTTTATTTCTAGCTATGCTGTCTCGAGACAGCATAGCTAGAAATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033660.1-2453s1c1
Sequence:CCGGCCTGCAAGTATCCAGAGAGTTCTCGAGAACTCTCTGGATACTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033660.1-2109s1c1
Sequence:CCGGCGTGGAATAATCAAAGCAAATCTCGAGATTTGCTTTGATTATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks