EMAIL THIS PAGE TO A FRIEND

C1orf185

chromosome 1 open reading frame 185

48 Gene Product Result for
Species: Human C1orf185(284546)
UniProtKB ID: Q5T7R7, A6NHS3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136508 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726547 Rosetta Predictions human pricing
XM_209252 Rosetta Predictions human pricing
XM_934643 Rosetta Predictions human pricing
XM_942420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00474934 predicted 458
2 SASI_Hs02_00474935 predicted 380
3 SASI_Hs02_00474936 predicted 385
4 SASI_Hs02_00474937 predicted 416
5 SASI_Hs02_00474938 predicted 395
6 SASI_Hs02_00474939 predicted 659
7 SASI_Hs02_00474940 predicted 672
8 SASI_Hs02_00474941 predicted 581
9 SASI_Hs02_00474942 predicted 560
10 SASI_Hs02_00474943 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269413 predicted 461
2 SASI_Hs01_00269415 predicted 383
3 SASI_Hs01_00269416 predicted 387
4 SASI_Hs01_00269417 predicted 418
5 SASI_Hs01_00269418 predicted 397
6 SASI_Hs01_00269419 predicted 661
7 SASI_Hs01_00269420 predicted 668
8 SASI_Hs01_00269421 predicted 576
9 SASI_Hs01_00269422 predicted 565
10 SASI_Hs02_00478964 predicted 354
11 SASI_Hs01_00269414 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264917 predicted 128
2 SASI_Hs01_00264918 predicted 251
3 SASI_Hs01_00264919 predicted 250
4 SASI_Hs01_00264920 predicted 252
5 SASI_Hs01_00264921 predicted 191
6 SASI_Hs01_00264922 predicted 236
7 SASI_Hs01_00264923 predicted 172
8 SASI_Hs01_00264924 predicted 263
9 SASI_Hs01_00264925 predicted 258
10 SASI_Hs01_00264926 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485439 predicted 463
2 SASI_Hs02_00485440 predicted 385
3 SASI_Hs02_00485441 predicted 385
4 SASI_Hs02_00485442 predicted 417
5 SASI_Hs02_00485443 predicted 397
6 SASI_Hs02_00485444 predicted 661
7 SASI_Hs02_00485445 predicted 665
8 SASI_Hs02_00485446 predicted 583
9 SASI_Hs02_00485447 predicted 565
10 SASI_Hs02_00485448 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136508
C1orf185 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 185
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-380s21c1
Sequence:CCGGATCGCAGCAGTGTTACATTAACTCGAGTTAATGTAACACTGCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-176s21c1
Sequence:CCGGGACCATCAATGGCGAAGATTACTCGAGTAATCTTCGCCATTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-235s21c1
Sequence:CCGGCATACTGGGAGATTCCAATTACTCGAGTAATTGGAATCTCCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-424s21c1
Sequence:CCGGTCTTATTACAGCCAAAGTATACTCGAGTATACTTTGGCTGTAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136508.1-734s21c1
Sequence:CCGGTAACATGTCCATGCTAATATTCTCGAGAATATTAGCATGGACATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136508
C1orf185 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 185
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-380s21c1
Sequence:CCGGATCGCAGCAGTGTTACATTAACTCGAGTTAATGTAACACTGCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-176s21c1
Sequence:CCGGGACCATCAATGGCGAAGATTACTCGAGTAATCTTCGCCATTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-235s21c1
Sequence:CCGGCATACTGGGAGATTCCAATTACTCGAGTAATTGGAATCTCCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-424s21c1
Sequence:CCGGTCTTATTACAGCCAAAGTATACTCGAGTATACTTTGGCTGTAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136508.1-734s21c1
Sequence:CCGGTAACATGTCCATGCTAATATTCTCGAGAATATTAGCATGGACATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136508
C1orf185 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 185
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-380s21c1
Sequence:CCGGATCGCAGCAGTGTTACATTAACTCGAGTTAATGTAACACTGCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-176s21c1
Sequence:CCGGGACCATCAATGGCGAAGATTACTCGAGTAATCTTCGCCATTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-235s21c1
Sequence:CCGGCATACTGGGAGATTCCAATTACTCGAGTAATTGGAATCTCCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136508.1-424s21c1
Sequence:CCGGTCTTATTACAGCCAAAGTATACTCGAGTATACTTTGGCTGTAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136508.1-734s21c1
Sequence:CCGGTAACATGTCCATGCTAATATTCTCGAGAATATTAGCATGGACATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks