EMAIL THIS PAGE TO A FRIEND

C1orf186

chromosome 1 open reading frame 186

34 Gene Product Result for
Species: Human C1orf186(440712)
UniProtKB ID: Q6ZWK4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007544 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101811 MISSION® esiRNA esiRNA human C1orf186 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007544 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220752 predicted 956
2 SASI_Hs02_00305336 predicted 849
3 SASI_Hs02_00305337 predicted 742
4 SASI_Hs01_00220753 predicted 759
5 SASI_Hs01_00220754 predicted 1175
6 SASI_Hs02_00305338 predicted 870
7 SASI_Hs01_00220756 predicted 900
8 SASI_Hs01_00220757 predicted 1173
9 SASI_Hs01_00220758 predicted 859
10 SASI_Hs01_00220759 predicted 1185
11 SASI_Hs01_00220755 predicted 1328
12 SASI_Hs01_00220760 predicted 862
13 SASI_Hs01_00220761 predicted 1448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007544
C1orf186 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 186
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000167544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007544.1-1030s1c1
Sequence:CCGGGACTATGAGAACATAAAGGAACTCGAGTTCCTTTATGTTCTCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007544.1-1449s1c1
Sequence:CCGGCTTTCAGGTAAAGTATGAGAACTCGAGTTCTCATACTTTACCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007544.1-1453s1c1
Sequence:CCGGCAGGTAAAGTATGAGAACTATCTCGAGATAGTTCTCATACTTTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007544.1-1036s1c1
Sequence:CCGGGAGAACATAAAGGAAATCACACTCGAGTGTGATTTCCTTTATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007544
C1orf186 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 186
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000167544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007544.1-1030s1c1
Sequence:CCGGGACTATGAGAACATAAAGGAACTCGAGTTCCTTTATGTTCTCATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007544.1-1449s1c1
Sequence:CCGGCTTTCAGGTAAAGTATGAGAACTCGAGTTCTCATACTTTACCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007544.1-1453s1c1
Sequence:CCGGCAGGTAAAGTATGAGAACTATCTCGAGATAGTTCTCATACTTTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007544.1-1036s1c1
Sequence:CCGGGAGAACATAAAGGAAATCACACTCGAGTGTGATTTCCTTTATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007544
C1orf186 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 186
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000167544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007544.1-1030s1c1
Sequence:CCGGGACTATGAGAACATAAAGGAACTCGAGTTCCTTTATGTTCTCATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007544.1-1449s1c1
Sequence:CCGGCTTTCAGGTAAAGTATGAGAACTCGAGTTCTCATACTTTACCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007544.1-1453s1c1
Sequence:CCGGCAGGTAAAGTATGAGAACTATCTCGAGATAGTTCTCATACTTTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007544.1-1036s1c1
Sequence:CCGGGAGAACATAAAGGAAATCACACTCGAGTGTGATTTCCTTTATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)