EMAIL THIS PAGE TO A FRIEND

C1orf189

chromosome 1 open reading frame 189

20 Gene Product Result for
Species: Human C1orf189(388701)
UniProtKB ID: Q5VU69, A1L4E3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010979 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125541 MISSION® esiRNA esiRNA human C1orf189 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010979 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223843 predicted 274
2 SASI_Hs01_00223844 predicted 311
3 SASI_Hs01_00223845 predicted 89
4 SASI_Hs02_00305952 predicted 112
5 SASI_Hs01_00223846 predicted 152
6 SASI_Hs01_00223847 predicted 319
7 SASI_Hs01_00223848 predicted 180
8 SASI_Hs01_00223849 predicted 169
9 SASI_Hs01_00223850 predicted 100
10 SASI_Hs01_00223851 predicted 217
11 SASI_Hs01_00223852 predicted 170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010979
C1orf189 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 189
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-217s21c1
Sequence:CCGGAGCAACTACTAATGGTCCGTCCTCGAGGACGGACCATTAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-145s21c1
Sequence:CCGGGCCAGAGAAGAAACCCGTATGCTCGAGCATACGGGTTTCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-116s21c1
Sequence:CCGGTACTCACTGTCTGTGGCAAATCTCGAGATTTGCCACAGACAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-184s21c1
Sequence:CCGGACACCATGGTACAGGAATTGGCTCGAGCCAATTCCTGTACCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010979
C1orf189 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 189
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-217s21c1
Sequence:CCGGAGCAACTACTAATGGTCCGTCCTCGAGGACGGACCATTAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-145s21c1
Sequence:CCGGGCCAGAGAAGAAACCCGTATGCTCGAGCATACGGGTTTCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-116s21c1
Sequence:CCGGTACTCACTGTCTGTGGCAAATCTCGAGATTTGCCACAGACAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-184s21c1
Sequence:CCGGACACCATGGTACAGGAATTGGCTCGAGCCAATTCCTGTACCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010979
C1orf189 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 189
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-217s21c1
Sequence:CCGGAGCAACTACTAATGGTCCGTCCTCGAGGACGGACCATTAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-145s21c1
Sequence:CCGGGCCAGAGAAGAAACCCGTATGCTCGAGCATACGGGTTTCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-116s21c1
Sequence:CCGGTACTCACTGTCTGTGGCAAATCTCGAGATTTGCCACAGACAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010979.1-184s21c1
Sequence:CCGGACACCATGGTACAGGAATTGGCTCGAGCCAATTCCTGTACCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks