EMAIL THIS PAGE TO A FRIEND

C1orf192

chromosome 1 open reading frame 192

Species: Human C1orf192(257177)
UniProtKB ID: Q5VTH2
Gene ID:
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013625 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132361 MISSION® esiRNA esiRNA human C1orf192 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013625 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079699 predicted 274
2 SASI_Hs01_00079701 predicted 415
3 SASI_Hs01_00079703 predicted 415
4 SASI_Hs01_00079704 predicted 394
5 SASI_Hs01_00079705 predicted 396
6 SASI_Hs01_00079706 predicted 412
7 SASI_Hs01_00079707 predicted 319
8 SASI_Hs01_00079708 predicted 326
9 SASI_Hs02_00306394 predicted 303
10 SASI_Hs02_00306395 predicted 516
11 SASI_Hs01_00079700 predicted 387
12 SASI_Hs01_00079702 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013625
C1orf192 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 192
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-519s1c1
Sequence:CCGGCCAAAGACCAGCCAAATCCTACTCGAGTAGGATTTGGCTGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-324s1c1
Sequence:CCGGCAATGGGCTGTGTCCTGAAATCTCGAGATTTCAGGACACAGCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-469s1c1
Sequence:CCGGCCAGATGAACTCCAAAGCTCACTCGAGTGAGCTTTGGAGTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-415s1c1
Sequence:CCGGCAAGCACGAAGTCCAACCATACTCGAGTATGGTTGGACTTCGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013625.1-615s1c1
Sequence:CCGGCTGGAACTTCATATGGACCAACTCGAGTTGGTCCATATGAAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-369s1c1
Sequence:CCGGCAGTCAGAAGAAACTCAGAAACTCGAGTTTCTGAGTTTCTTCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013625.1-593s1c1
Sequence:CCGGGCTGAGGTCCAGAAATACAAACTCGAGTTTGTATTTCTGGACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-307s1c1
Sequence:CCGGGATTTACTCAAGGCCTCCAATCTCGAGATTGGAGGCCTTGAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013625
C1orf192 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 192
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-519s1c1
Sequence:CCGGCCAAAGACCAGCCAAATCCTACTCGAGTAGGATTTGGCTGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-324s1c1
Sequence:CCGGCAATGGGCTGTGTCCTGAAATCTCGAGATTTCAGGACACAGCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-469s1c1
Sequence:CCGGCCAGATGAACTCCAAAGCTCACTCGAGTGAGCTTTGGAGTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-415s1c1
Sequence:CCGGCAAGCACGAAGTCCAACCATACTCGAGTATGGTTGGACTTCGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013625.1-615s1c1
Sequence:CCGGCTGGAACTTCATATGGACCAACTCGAGTTGGTCCATATGAAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-369s1c1
Sequence:CCGGCAGTCAGAAGAAACTCAGAAACTCGAGTTTCTGAGTTTCTTCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013625.1-593s1c1
Sequence:CCGGGCTGAGGTCCAGAAATACAAACTCGAGTTTGTATTTCTGGACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-307s1c1
Sequence:CCGGGATTTACTCAAGGCCTCCAATCTCGAGATTGGAGGCCTTGAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013625
C1orf192 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 192
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-519s1c1
Sequence:CCGGCCAAAGACCAGCCAAATCCTACTCGAGTAGGATTTGGCTGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-324s1c1
Sequence:CCGGCAATGGGCTGTGTCCTGAAATCTCGAGATTTCAGGACACAGCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-469s1c1
Sequence:CCGGCCAGATGAACTCCAAAGCTCACTCGAGTGAGCTTTGGAGTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013625.1-415s1c1
Sequence:CCGGCAAGCACGAAGTCCAACCATACTCGAGTATGGTTGGACTTCGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013625.1-615s1c1
Sequence:CCGGCTGGAACTTCATATGGACCAACTCGAGTTGGTCCATATGAAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-369s1c1
Sequence:CCGGCAGTCAGAAGAAACTCAGAAACTCGAGTTTCTGAGTTTCTTCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013625.1-593s1c1
Sequence:CCGGGCTGAGGTCCAGAAATACAAACTCGAGTTTGTATTTCTGGACCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013625.1-307s1c1
Sequence:CCGGGATTTACTCAAGGCCTCCAATCTCGAGATTGGAGGCCTTGAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks