EMAIL THIS PAGE TO A FRIEND

C1orf194

chromosome 1 open reading frame 194

Species: Human C1orf194(127003)
UniProtKB ID: Q5T5A4, Q5T5A3
Gene ID:
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001122961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001122961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001122961 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109161 MISSION® esiRNA esiRNA human C1orf194 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122961 Rosetta Predictions human pricing
XM_059104 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327597 predicted 437
2 SASI_Hs02_00327598 predicted 302
3 SASI_Hs02_00327599 predicted 498
4 SASI_Hs02_00327600 predicted 363
5 SASI_Hs02_00327601 predicted 365
6 SASI_Hs02_00327602 predicted 228
7 SASI_Hs02_00327603 predicted 503
8 SASI_Hs02_00327604 predicted 413
9 SASI_Hs02_00327605 predicted 438
10 SASI_Hs02_00327606 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278294 predicted 437
2 SASI_Hs01_00278295 predicted 305
3 SASI_Hs01_00278296 predicted 496
4 SASI_Hs01_00278297 predicted 366
5 SASI_Hs01_00278298 predicted 364
6 SASI_Hs01_00278299 predicted 222
7 SASI_Hs01_00278300 predicted 310
8 SASI_Hs01_00278301 predicted 336
9 SASI_Hs01_00278302 predicted 440
10 SASI_Hs01_00278303 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122961
C1orf194 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 194
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-353s21c1
Sequence:CCGGATGACCTGGACTTCCGCTTAGCTCGAGCTAAGCGGAAGTCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-507s21c1
Sequence:CCGGCATCACTTTCCTGGCTAACATCTCGAGATGTTAGCCAGGAAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-563s21c1
Sequence:CCGGACAGCATCCAAGGATCCATAGCTCGAGCTATGGATCCTTGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-453s21c1
Sequence:CCGGCTATAGAACCAAGATCCAATTCTCGAGAATTGGATCTTGGTTCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-312s21c1
Sequence:CCGGGAGGCGGGATGCCTACTATTTCTCGAGAAATAGTAGGCATCCCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122961
C1orf194 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 194
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-353s21c1
Sequence:CCGGATGACCTGGACTTCCGCTTAGCTCGAGCTAAGCGGAAGTCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-507s21c1
Sequence:CCGGCATCACTTTCCTGGCTAACATCTCGAGATGTTAGCCAGGAAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-563s21c1
Sequence:CCGGACAGCATCCAAGGATCCATAGCTCGAGCTATGGATCCTTGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-453s21c1
Sequence:CCGGCTATAGAACCAAGATCCAATTCTCGAGAATTGGATCTTGGTTCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-312s21c1
Sequence:CCGGGAGGCGGGATGCCTACTATTTCTCGAGAAATAGTAGGCATCCCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122961
C1orf194 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 194
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-353s21c1
Sequence:CCGGATGACCTGGACTTCCGCTTAGCTCGAGCTAAGCGGAAGTCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-507s21c1
Sequence:CCGGCATCACTTTCCTGGCTAACATCTCGAGATGTTAGCCAGGAAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-563s21c1
Sequence:CCGGACAGCATCCAAGGATCCATAGCTCGAGCTATGGATCCTTGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-453s21c1
Sequence:CCGGCTATAGAACCAAGATCCAATTCTCGAGAATTGGATCTTGGTTCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122961.1-312s21c1
Sequence:CCGGGAGGCGGGATGCCTACTATTTCTCGAGAAATAGTAGGCATCCCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks