EMAIL THIS PAGE TO A FRIEND

C1orf210

chromosome 1 open reading frame 210

Species: Human C1orf210(149466)
UniProtKB ID: Q8IVY1, D3DPX2
Gene ID:
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182517 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054881 MISSION® esiRNA esiRNA human C1orf210 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182517 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370597 predicted 815
2 SASI_Hs02_00370598 predicted 739
3 SASI_Hs01_00170722 predicted 495
4 SASI_Hs02_00370599 predicted 612
5 SASI_Hs02_00370600 predicted 560
6 SASI_Hs02_00370601 predicted 799
7 SASI_Hs02_00370602 predicted 792
8 SASI_Hs02_00370603 predicted 730
9 SASI_Hs02_00370604 predicted 567
10 SASI_Hs02_00370605 predicted 494
11 SASI_Hs01_00170719 predicted 315
12 SASI_Hs01_00170720 predicted 390
13 SASI_Hs01_00170721 predicted 446
14 SASI_Hs01_00170723 predicted 319
15 SASI_Hs01_00170724 predicted 350
16 SASI_Hs01_00170725 predicted 422
17 SASI_Hs01_00170726 predicted 393
18 SASI_Hs01_00170727 predicted 367
19 SASI_Hs01_00170728 predicted 346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182517
C1orf210 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 210
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-364s1c1
Sequence:CCGGCATTGCACTTGCTGCCAAATGCTCGAGCATTTGGCAGCAAGTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-362s1c1
Sequence:CCGGCTCATTGCACTTGCTGCCAAACTCGAGTTTGGCAGCAAGTGCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-486s1c1
Sequence:CCGGGCTTCATCGAGGACAATTACACTCGAGTGTAATTGTCCTCGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182517.1-1011s1c1
Sequence:CCGGGCATTTCAAATATGCCCAGATCTCGAGATCTGGGCATATTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182517.1-774s1c1
Sequence:CCGGCTCAGGATAAAGCCAAACAAACTCGAGTTTGTTTGGCTTTATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-464s1c1
Sequence:CCGGGCTGAAGATGAGGATGATGATCTCGAGATCATCATCCTCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-470s1c1
Sequence:CCGGGATGAGGATGATGATGGCTTCCTCGAGGAAGCCATCATCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-482s1c1
Sequence:CCGGGATGGCTTCATCGAGGACAATCTCGAGATTGTCCTCGATGAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182517.2-568s21c1
Sequence:CCGGTCCCTCTGAGCTCCCATCTTTCTCGAGAAAGATGGGAGCTCAGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182517.2-969s21c1
Sequence:CCGGACGCTACTCTTCTCCTAAATCCTCGAGGATTTAGGAGAAGAGTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182517.2-324s21c1
Sequence:CCGGATGGCCTGTGCTGGTAGGATTCTCGAGAATCCTACCAGCACAGGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182517
C1orf210 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 210
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-364s1c1
Sequence:CCGGCATTGCACTTGCTGCCAAATGCTCGAGCATTTGGCAGCAAGTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-362s1c1
Sequence:CCGGCTCATTGCACTTGCTGCCAAACTCGAGTTTGGCAGCAAGTGCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-486s1c1
Sequence:CCGGGCTTCATCGAGGACAATTACACTCGAGTGTAATTGTCCTCGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182517.1-1011s1c1
Sequence:CCGGGCATTTCAAATATGCCCAGATCTCGAGATCTGGGCATATTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182517.1-774s1c1
Sequence:CCGGCTCAGGATAAAGCCAAACAAACTCGAGTTTGTTTGGCTTTATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-464s1c1
Sequence:CCGGGCTGAAGATGAGGATGATGATCTCGAGATCATCATCCTCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-470s1c1
Sequence:CCGGGATGAGGATGATGATGGCTTCCTCGAGGAAGCCATCATCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-482s1c1
Sequence:CCGGGATGGCTTCATCGAGGACAATCTCGAGATTGTCCTCGATGAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182517.2-568s21c1
Sequence:CCGGTCCCTCTGAGCTCCCATCTTTCTCGAGAAAGATGGGAGCTCAGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182517.2-969s21c1
Sequence:CCGGACGCTACTCTTCTCCTAAATCCTCGAGGATTTAGGAGAAGAGTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182517.2-324s21c1
Sequence:CCGGATGGCCTGTGCTGGTAGGATTCTCGAGAATCCTACCAGCACAGGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182517
C1orf210 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 210
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-364s1c1
Sequence:CCGGCATTGCACTTGCTGCCAAATGCTCGAGCATTTGGCAGCAAGTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-362s1c1
Sequence:CCGGCTCATTGCACTTGCTGCCAAACTCGAGTTTGGCAGCAAGTGCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-486s1c1
Sequence:CCGGGCTTCATCGAGGACAATTACACTCGAGTGTAATTGTCCTCGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182517.1-1011s1c1
Sequence:CCGGGCATTTCAAATATGCCCAGATCTCGAGATCTGGGCATATTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182517.1-774s1c1
Sequence:CCGGCTCAGGATAAAGCCAAACAAACTCGAGTTTGTTTGGCTTTATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-464s1c1
Sequence:CCGGGCTGAAGATGAGGATGATGATCTCGAGATCATCATCCTCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-470s1c1
Sequence:CCGGGATGAGGATGATGATGGCTTCCTCGAGGAAGCCATCATCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182517.1-482s1c1
Sequence:CCGGGATGGCTTCATCGAGGACAATCTCGAGATTGTCCTCGATGAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182517.2-568s21c1
Sequence:CCGGTCCCTCTGAGCTCCCATCTTTCTCGAGAAAGATGGGAGCTCAGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182517.2-969s21c1
Sequence:CCGGACGCTACTCTTCTCCTAAATCCTCGAGGATTTAGGAGAAGAGTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182517.2-324s21c1
Sequence:CCGGATGGCCTGTGCTGGTAGGATTCTCGAGAATCCTACCAGCACAGGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks