EMAIL THIS PAGE TO A FRIEND

C1orf213

chromosome 1 open reading frame 213

83 Gene Product Result for
Species: Human C1orf213(148898)
UniProtKB ID: Q8NC38, Q2VPR7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138479 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107681 MISSION® esiRNA esiRNA human C1orf213 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008896 Rosetta Predictions human pricing
NM_138479 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215678 predicted 778
2 SASI_Hs01_00215679 predicted 381
3 SASI_Hs02_00305591 predicted 698
4 SASI_Hs02_00305592 predicted 771
5 SASI_Hs01_00215682 predicted 725
6 SASI_Hs01_00215683 predicted 769
7 SASI_Hs01_00215685 predicted 617
8 SASI_Hs01_00215686 predicted 695
9 SASI_Hs02_00305593 predicted 650
10 SASI_Hs02_00305594 predicted 609
11 SASI_Hs01_00215677 predicted 710
12 SASI_Hs01_00215680 predicted 421
13 SASI_Hs01_00215681 predicted 485
14 SASI_Hs01_00215684 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229306 predicted 1164
2 SASI_Hs02_00363669 predicted 1176
3 SASI_Hs01_00229305 predicted 588
4 SASI_Hs01_00229307 predicted 574
5 SASI_Hs01_00229308 predicted 592
6 SASI_Hs01_00229309 predicted 654
7 SASI_Hs01_00229310 predicted 420
8 SASI_Hs01_00229311 predicted 479
9 SASI_Hs01_00229312 predicted 579
10 SASI_Hs01_00229313 predicted 683
11 SASI_Hs01_00229314 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138479
VALIDATED
C1orf213 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 213
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138479.2-390s21c1
Sequence:CCGGACTTACCTCCTGTCCCGCAAACTCGAGTTTGCGGGACAGGAGGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138479.2-1104s21c1
Sequence:CCGGGTTCCCAGTGCCCGGTTATTTCTCGAGAAATAACCGGGCACTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138479.2-770s21c1
Sequence:CCGGGGATGAGGGAATTAGACAATGCTCGAGCATTGTCTAATTCCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138479.2-1674s1c1
Sequence:CCGGCCAGAAATGCTTGTGGGTATACTCGAGTATACCCACAAGCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138479.2-489s1c1
Sequence:CCGGCGTTCAGGAAGATTCTAGAGACTCGAGTCTCTAGAATCTTCCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138479.2-416s1c1
Sequence:CCGGCACTAGATCGTCGTCTCCAAACTCGAGTTTGGAGACGACGATCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138479.1-601s1c1
Sequence:CCGGCCAAGAAACCACCAGCAACTACTCGAGTAGTTGCTGGTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138479.2-1354s1c1
Sequence:CCGGCCACTGCTAAATTTGGCTATACTCGAGTATAGCCAAATTTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138479
VALIDATED
C1orf213 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 213
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138479.2-390s21c1
Sequence:CCGGACTTACCTCCTGTCCCGCAAACTCGAGTTTGCGGGACAGGAGGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138479.2-1104s21c1
Sequence:CCGGGTTCCCAGTGCCCGGTTATTTCTCGAGAAATAACCGGGCACTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138479.2-770s21c1
Sequence:CCGGGGATGAGGGAATTAGACAATGCTCGAGCATTGTCTAATTCCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138479.2-1674s1c1
Sequence:CCGGCCAGAAATGCTTGTGGGTATACTCGAGTATACCCACAAGCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138479.2-489s1c1
Sequence:CCGGCGTTCAGGAAGATTCTAGAGACTCGAGTCTCTAGAATCTTCCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138479.2-416s1c1
Sequence:CCGGCACTAGATCGTCGTCTCCAAACTCGAGTTTGGAGACGACGATCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138479.1-601s1c1
Sequence:CCGGCCAAGAAACCACCAGCAACTACTCGAGTAGTTGCTGGTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138479.2-1354s1c1
Sequence:CCGGCCACTGCTAAATTTGGCTATACTCGAGTATAGCCAAATTTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138479
VALIDATED
C1orf213 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 213
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138479.2-390s21c1
Sequence:CCGGACTTACCTCCTGTCCCGCAAACTCGAGTTTGCGGGACAGGAGGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138479.2-1104s21c1
Sequence:CCGGGTTCCCAGTGCCCGGTTATTTCTCGAGAAATAACCGGGCACTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138479.2-770s21c1
Sequence:CCGGGGATGAGGGAATTAGACAATGCTCGAGCATTGTCTAATTCCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138479.2-1674s1c1
Sequence:CCGGCCAGAAATGCTTGTGGGTATACTCGAGTATACCCACAAGCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138479.2-489s1c1
Sequence:CCGGCGTTCAGGAAGATTCTAGAGACTCGAGTCTCTAGAATCTTCCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138479.2-416s1c1
Sequence:CCGGCACTAGATCGTCGTCTCCAAACTCGAGTTTGGAGACGACGATCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138479.1-601s1c1
Sequence:CCGGCCAAGAAACCACCAGCAACTACTCGAGTAGTTGCTGGTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138479.2-1354s1c1
Sequence:CCGGCCACTGCTAAATTTGGCTATACTCGAGTATAGCCAAATTTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks