EMAIL THIS PAGE TO A FRIEND

C1orf216

chromosome 1 open reading frame 216

41 Gene Product Result for
UniProtKB ID: Q8TAB5, D3DPS1, Q8N8N6
Gene ID:
chicken(770397) chromosome 23 open reading frame, human C1orf216
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054471 MISSION® esiRNA esiRNA human C1orf216 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011848 predicted 1323
2 SASI_Hs02_00366024 predicted 1429
3 SASI_Hs01_00011849 predicted 1656
4 SASI_Hs01_00011850 predicted 1409
5 SASI_Hs01_00011851 predicted 1245
6 SASI_Hs01_00011852 predicted 1646
7 SASI_Hs01_00011853 predicted 1376
8 SASI_Hs01_00011854 predicted 1561
9 SASI_Hs01_00011855 predicted 1398
10 SASI_Hs02_00366025 predicted 1553
11 SASI_Hs01_00011856 predicted 1339
12 SASI_Hs01_00011857 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152374
C1orf216 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 216
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152374.1-603s1c1
Sequence:CCGGGCCAAGGATGCTAACGAGAATCTCGAGATTCTCGTTAGCATCCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152374.1-1567s1c1
Sequence:CCGGGCAGGCTTGTATTAGGTGTATCTCGAGATACACCTAATACAAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152374.1-1190s21c1
Sequence:CCGGCACAAGTGTGCAAGGGTATATCTCGAGATATACCCTTGCACACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-950s21c1
Sequence:CCGGACAAGTCCAGGAGCGCTACAACTCGAGTTGTAGCGCTCCTGGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-537s21c1
Sequence:CCGGGACCCACCTCCTGGATTATGTCTCGAGACATAATCCAGGAGGTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-603s21c1
Sequence:CCGGGCCAAGGATGCTAACGAGAATCTCGAGATTCTCGTTAGCATCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-1108s21c1
Sequence:CCGGACAACCGGAAGGAGCTTATTCCTCGAGGAATAAGCTCCTTCCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152374
C1orf216 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 216
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152374.1-603s1c1
Sequence:CCGGGCCAAGGATGCTAACGAGAATCTCGAGATTCTCGTTAGCATCCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152374.1-1567s1c1
Sequence:CCGGGCAGGCTTGTATTAGGTGTATCTCGAGATACACCTAATACAAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152374.1-1190s21c1
Sequence:CCGGCACAAGTGTGCAAGGGTATATCTCGAGATATACCCTTGCACACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-950s21c1
Sequence:CCGGACAAGTCCAGGAGCGCTACAACTCGAGTTGTAGCGCTCCTGGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-537s21c1
Sequence:CCGGGACCCACCTCCTGGATTATGTCTCGAGACATAATCCAGGAGGTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-603s21c1
Sequence:CCGGGCCAAGGATGCTAACGAGAATCTCGAGATTCTCGTTAGCATCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-1108s21c1
Sequence:CCGGACAACCGGAAGGAGCTTATTCCTCGAGGAATAAGCTCCTTCCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152374
C1orf216 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 216
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152374.1-603s1c1
Sequence:CCGGGCCAAGGATGCTAACGAGAATCTCGAGATTCTCGTTAGCATCCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152374.1-1567s1c1
Sequence:CCGGGCAGGCTTGTATTAGGTGTATCTCGAGATACACCTAATACAAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152374.1-1190s21c1
Sequence:CCGGCACAAGTGTGCAAGGGTATATCTCGAGATATACCCTTGCACACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-950s21c1
Sequence:CCGGACAAGTCCAGGAGCGCTACAACTCGAGTTGTAGCGCTCCTGGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-537s21c1
Sequence:CCGGGACCCACCTCCTGGATTATGTCTCGAGACATAATCCAGGAGGTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-603s21c1
Sequence:CCGGGCCAAGGATGCTAACGAGAATCTCGAGATTCTCGTTAGCATCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152374.1-1108s21c1
Sequence:CCGGACAACCGGAAGGAGCTTATTCCTCGAGGAATAAGCTCCTTCCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)