EMAIL THIS PAGE TO A FRIEND

C1orf21

chromosome 1 open reading frame 21

317 Gene Product Result for
Synonyms: PIG13
Species: Human C1orf21(81563)
UniProtKB ID: Q9H246, B2R551
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030806 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026941 MISSION® esiRNA esiRNA human C1orf21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030806 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203665 predicted 498
2 SASI_Hs01_00203666 predicted 556
3 SASI_Hs02_00358374 predicted 490
4 SASI_Hs01_00203667 predicted 808
5 SASI_Hs02_00358375 predicted 809
6 SASI_Hs01_00203672 predicted 1202
7 SASI_Hs01_00203673 predicted 558
8 SASI_Hs01_00203674 predicted 866
9 SASI_Hs02_00358376 predicted 1137
10 SASI_Hs02_00358377 predicted 556
11 SASI_Hs01_00203668 predicted 721
12 SASI_Hs01_00203669 predicted 741
13 SASI_Hs01_00203670 predicted 902
14 SASI_Hs01_00203671 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030806
VALIDATED
C1orf21 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 21
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-548s1c1
Sequence:CCGGGAGATGTGTTTGGCGATGAGTCTCGAGACTCATCGCCAAACACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-700s1c1
Sequence:CCGGGAGGTTCCGGGATTAGTTCATCTCGAGATGAACTAATCCCGGAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-668s1c1
Sequence:CCGGCCAGCTCAAATGTAAGACTTACTCGAGTAAGTCTTACATTTGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-730s1c1
Sequence:CCGGGCAAACATGCACATCTCTGAACTCGAGTTCAGAGATGTGCATGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-812s1c1
Sequence:CCGGCGGAAGAAGAGGATATCACATCTCGAGATGTGATATCCTCTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030806.2-692s1c1
Sequence:CCGGCTAATAAAGAGGTTCCGGGATCTCGAGATCCCGGAACCTCTTTATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-583s1c1
Sequence:CCGGGTGGAAGAGGTCAAATACATGCTCGAGCATGTATTTGACCTCTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-667s1c1
Sequence:CCGGGCCAGCTCAAATGTAAGACTTCTCGAGAAGTCTTACATTTGAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-576s1c1
Sequence:CCGGCAAACCAGTGGAAGAGGTCAACTCGAGTTGACCTCTTCCACTGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030806
VALIDATED
C1orf21 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 21
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-548s1c1
Sequence:CCGGGAGATGTGTTTGGCGATGAGTCTCGAGACTCATCGCCAAACACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-700s1c1
Sequence:CCGGGAGGTTCCGGGATTAGTTCATCTCGAGATGAACTAATCCCGGAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-668s1c1
Sequence:CCGGCCAGCTCAAATGTAAGACTTACTCGAGTAAGTCTTACATTTGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-730s1c1
Sequence:CCGGGCAAACATGCACATCTCTGAACTCGAGTTCAGAGATGTGCATGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-812s1c1
Sequence:CCGGCGGAAGAAGAGGATATCACATCTCGAGATGTGATATCCTCTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030806.2-692s1c1
Sequence:CCGGCTAATAAAGAGGTTCCGGGATCTCGAGATCCCGGAACCTCTTTATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-583s1c1
Sequence:CCGGGTGGAAGAGGTCAAATACATGCTCGAGCATGTATTTGACCTCTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-667s1c1
Sequence:CCGGGCCAGCTCAAATGTAAGACTTCTCGAGAAGTCTTACATTTGAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-576s1c1
Sequence:CCGGCAAACCAGTGGAAGAGGTCAACTCGAGTTGACCTCTTCCACTGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030806
VALIDATED
C1orf21 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 21
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-548s1c1
Sequence:CCGGGAGATGTGTTTGGCGATGAGTCTCGAGACTCATCGCCAAACACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-700s1c1
Sequence:CCGGGAGGTTCCGGGATTAGTTCATCTCGAGATGAACTAATCCCGGAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-668s1c1
Sequence:CCGGCCAGCTCAAATGTAAGACTTACTCGAGTAAGTCTTACATTTGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-730s1c1
Sequence:CCGGGCAAACATGCACATCTCTGAACTCGAGTTCAGAGATGTGCATGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-812s1c1
Sequence:CCGGCGGAAGAAGAGGATATCACATCTCGAGATGTGATATCCTCTTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030806.2-692s1c1
Sequence:CCGGCTAATAAAGAGGTTCCGGGATCTCGAGATCCCGGAACCTCTTTATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030806.2-583s1c1
Sequence:CCGGGTGGAAGAGGTCAAATACATGCTCGAGCATGTATTTGACCTCTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-667s1c1
Sequence:CCGGGCCAGCTCAAATGTAAGACTTCTCGAGAAGTCTTACATTTGAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030806.2-576s1c1
Sequence:CCGGCAAACCAGTGGAAGAGGTCAACTCGAGTTGACCTCTTCCACTGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)