EMAIL THIS PAGE TO A FRIEND

C1orf220

chromosome 1 open reading frame 220

116 Gene Product Result for
Species: Human C1orf220(400798)
UniProtKB ID: Q5T0J3, B2RN72, Q8NAD3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207467 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106171 MISSION® esiRNA esiRNA human RP5-990P15.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207467 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220430 predicted 686
2 SASI_Hs01_00220431 predicted 735
3 SASI_Hs01_00220432 predicted 686
4 SASI_Hs01_00220433 predicted 658
5 SASI_Hs01_00220434 predicted 691
6 SASI_Hs02_00374091 predicted 685
7 SASI_Hs02_00374092 predicted 759
8 SASI_Hs01_00220437 predicted 661
9 SASI_Hs02_00374093 predicted 690
10 SASI_Hs01_00220439 predicted 642
11 SASI_Hs01_00220435 predicted 738
12 SASI_Hs01_00220436 predicted 659
13 SASI_Hs01_00220438 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207467
C1orf220 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 220
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168524    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207467.1-2197s1c1
Sequence:CCGGGCCAAGAAACAAGTCACCAAACTCGAGTTTGGTGACTTGTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-393s1c1
Sequence:CCGGGCAAGTAAAGAAAGTGAGATTCTCGAGAATCTCACTTTCTTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-616s1c1
Sequence:CCGGCTGAACAGTGATCTTCAGTTTCTCGAGAAACTGAAGATCACTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207467.1-2390s1c1
Sequence:CCGGGCTGACATCAAACTGAATATACTCGAGTATATTCAGTTTGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-692s1c1
Sequence:CCGGGCTGCTTAAGCCGATTATCATCTCGAGATGATAATCGGCTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207467
C1orf220 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 220
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168524    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207467.1-2197s1c1
Sequence:CCGGGCCAAGAAACAAGTCACCAAACTCGAGTTTGGTGACTTGTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-393s1c1
Sequence:CCGGGCAAGTAAAGAAAGTGAGATTCTCGAGAATCTCACTTTCTTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-616s1c1
Sequence:CCGGCTGAACAGTGATCTTCAGTTTCTCGAGAAACTGAAGATCACTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207467.1-2390s1c1
Sequence:CCGGGCTGACATCAAACTGAATATACTCGAGTATATTCAGTTTGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-692s1c1
Sequence:CCGGGCTGCTTAAGCCGATTATCATCTCGAGATGATAATCGGCTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207467
C1orf220 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 220
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168524    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207467.1-2197s1c1
Sequence:CCGGGCCAAGAAACAAGTCACCAAACTCGAGTTTGGTGACTTGTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-393s1c1
Sequence:CCGGGCAAGTAAAGAAAGTGAGATTCTCGAGAATCTCACTTTCTTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-616s1c1
Sequence:CCGGCTGAACAGTGATCTTCAGTTTCTCGAGAAACTGAAGATCACTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207467.1-2390s1c1
Sequence:CCGGGCTGACATCAAACTGAATATACTCGAGTATATTCAGTTTGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207467.1-692s1c1
Sequence:CCGGGCTGCTTAAGCCGATTATCATCTCGAGATGATAATCGGCTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks