EMAIL THIS PAGE TO A FRIEND

C1orf222

chromosome 1 open reading frame 222

13 Gene Product Result for
Species: Human C1orf222(339457)
UniProtKB ID: Q69YW0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003808 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103771 MISSION® esiRNA esiRNA human C1orf222 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003808 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121046 predicted 2371
2 SASI_Hs01_00121047 predicted 1848
3 SASI_Hs01_00121048 predicted 2177
4 SASI_Hs01_00121049 predicted 1550
5 SASI_Hs01_00121050 predicted 1741
6 SASI_Hs01_00121051 predicted 2186
7 SASI_Hs01_00121052 predicted 1929
8 SASI_Hs01_00121054 predicted 1538
9 SASI_Hs01_00121055 predicted 1568
10 SASI_Hs02_00304397 predicted 2089
11 SASI_Hs01_00121053 predicted 2227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003808
C1orf222 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 222
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2090s1c1
Sequence:CCGGCCTGGACTACATCCAGTTTGACTCGAGTCAAACTGGATGTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-1559s1c1
Sequence:CCGGCCTCAACATGGGCTATGTGATCTCGAGATCACATAGCCCATGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2175s1c1
Sequence:CCGGCCATCTCCAAAGAAGACCGTTCTCGAGAACGGTCTTCTTTGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-1634s1c1
Sequence:CCGGCATCAAGTTCTCCATGCACCTCTCGAGAGGTGCATGGAGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2186s1c1
Sequence:CCGGGAAGACCGTTGAGTTCAGCATCTCGAGATGCTGAACTCAACGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2375s1c1
Sequence:CCGGGAAGGAGACCTACAAGGTCATCTCGAGATGACCTTGTAGGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2387s1c1
Sequence:CCGGCAAGGTCATCTTTGTAGCCCACTCGAGTGGGCTACAAAGATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2189s1c1
Sequence:CCGGGACCGTTGAGTTCAGCATAGACTCGAGTCTATGCTGAACTCAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003808.1-2528s1c1
Sequence:CCGGCTCTGCCAGTCAGATTCCAATCTCGAGATTGGAATCTGACTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2393s1c1
Sequence:CCGGCATCTTTGTAGCCCAGGTGTTCTCGAGAACACCTGGGCTACAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003808
C1orf222 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 222
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2090s1c1
Sequence:CCGGCCTGGACTACATCCAGTTTGACTCGAGTCAAACTGGATGTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-1559s1c1
Sequence:CCGGCCTCAACATGGGCTATGTGATCTCGAGATCACATAGCCCATGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2175s1c1
Sequence:CCGGCCATCTCCAAAGAAGACCGTTCTCGAGAACGGTCTTCTTTGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-1634s1c1
Sequence:CCGGCATCAAGTTCTCCATGCACCTCTCGAGAGGTGCATGGAGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2186s1c1
Sequence:CCGGGAAGACCGTTGAGTTCAGCATCTCGAGATGCTGAACTCAACGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2375s1c1
Sequence:CCGGGAAGGAGACCTACAAGGTCATCTCGAGATGACCTTGTAGGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2387s1c1
Sequence:CCGGCAAGGTCATCTTTGTAGCCCACTCGAGTGGGCTACAAAGATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2189s1c1
Sequence:CCGGGACCGTTGAGTTCAGCATAGACTCGAGTCTATGCTGAACTCAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003808.1-2528s1c1
Sequence:CCGGCTCTGCCAGTCAGATTCCAATCTCGAGATTGGAATCTGACTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2393s1c1
Sequence:CCGGCATCTTTGTAGCCCAGGTGTTCTCGAGAACACCTGGGCTACAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003808
C1orf222 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 222
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2090s1c1
Sequence:CCGGCCTGGACTACATCCAGTTTGACTCGAGTCAAACTGGATGTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-1559s1c1
Sequence:CCGGCCTCAACATGGGCTATGTGATCTCGAGATCACATAGCCCATGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2175s1c1
Sequence:CCGGCCATCTCCAAAGAAGACCGTTCTCGAGAACGGTCTTCTTTGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-1634s1c1
Sequence:CCGGCATCAAGTTCTCCATGCACCTCTCGAGAGGTGCATGGAGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2186s1c1
Sequence:CCGGGAAGACCGTTGAGTTCAGCATCTCGAGATGCTGAACTCAACGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2375s1c1
Sequence:CCGGGAAGGAGACCTACAAGGTCATCTCGAGATGACCTTGTAGGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2387s1c1
Sequence:CCGGCAAGGTCATCTTTGTAGCCCACTCGAGTGGGCTACAAAGATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2189s1c1
Sequence:CCGGGACCGTTGAGTTCAGCATAGACTCGAGTCTATGCTGAACTCAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003808.1-2528s1c1
Sequence:CCGGCTCTGCCAGTCAGATTCCAATCTCGAGATTGGAATCTGACTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003808.1-2393s1c1
Sequence:CCGGCATCTTTGTAGCCCAGGTGTTCTCGAGAACACCTGGGCTACAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks